Description :
From Genome Similarity Track
Location :
contig_192:3692- 4988
Transcript NameFunction/comments
g12010.t1hypothetical protein

Sequence
1296 bases(100 bases per row)
CTCGGGTTCGTGGAGTGGGCGTGTCGGGGGCGTGCTGAAACCGTCGTCAACACTGGGTTCTTCGGTGCGCTCCTCTTCTTCATCGTTGTCGATGATGTCG
ATCACCTTCTGGTTGCGCGTCTTCGCCATTGTGACCGGTGGCGCTTCAGCAAACGTCACACTCCTTGAAATCACGATCAATCCGTCGCTGGGGTCCAGGA
GTCGATATGCTTTGTGTTGCTTGGCGTAGCCGAGAAACACGCACTTGATCCCCGAGTTGTCCAGCATTTTGCGTTTCTGCTTGGTCACATGGGCGTAGCA
CTCGGTCCCAAAACGCGCATGTGCTCCAGACGTGGCGCCCTCTTGAAAACCAGGTGGAATGGGCTTGCGTGTGGGCTTGACGTGTTAGGCAACACGTTCC
GAATGTCTGCAGCTGACATGATGGCTTCGCACCAGTACGACTTGTCCATCCCGCTCTCCTCCAGCATGCAGCGTGTCATTTCGACCAGCGTACGGTTCAT
CCGCTCTGCCATGCCGTTCTGTTGCGGGTTGTAAGGCACCGTGAACTCTTGCTTGATGGTCTTCTCGTCGCACAGAGCCACCATCCCCGCGTTGCAGTAT
TCACCGCCGTTGTCACTGCGTAGCACCTTGACCTTGATGCCCGCACTTGTTTCTGCCTCCTTGAGAAACTTCTTGAACGCCTCACACACTTCGCTCTTCT
TGCGCAGTGGGTAGATTGTCACAAAGCGACTCTTCATCATGATGAAGCTCACAATGTACTTGTAGCCTGACTTGGATGCAGGAGTGACGGGCCCCAACAC
ATCAGAGCACACAGTGGTGTCCTTGCGTGCGCTCTCCCTGGCTTCGAGTCCCTCCTTGGTCGACTTGAAAGGCTTGCGTGCCTGCTTCGCAGTCGCACAC
ACGCCACACACGGTTCCAGGCTCTGCCAGTGCACCCTTGAGTTTCCCGTCCTTGATAATGGAGTTCAGCGTGCCGAAAGACGCGTGGCCGAGTCGCCGGT
GCCACAAATCCATATTGTCTTCAGCCGCATGGCACTCGTCGCCGCCCTCAATGTTGAGGAACATCAGCTTGCCTTGCTTCCTGCCCGTCGCCACCACTTG
GCCGCCGCGTTTCACAACGCACTGCTCGCTGTCCATAGTCACGGTCATGCCGCGTGCCGTTGCAGCCGTGAGAGAGAACAGGTTCTTGTTCAAATCTTGA
ACGTGCAGTGTGTTTTCCAGTCGCGCGTTTATCCACGCACTACCAGTCCAGACACGCAGAACAACTGTTCCAACCCCGAGAATCTTCAAGCTCGCG