Description :
From Genome Similarity Track
Location :
Scaffold_138:36918- 38413
Sequence
1495 bases(100 bases per row)
CCACCCAGGCCTTGAGTACACGCAGGGCCAAAGATCCACAGGGGGCGTCCAGGGTGACCAACTTGAACTGCACTTGGCGGTCGACCTTGAGGGCAGGTGC
TAGGCCATACGGCTGGATCACGGATGGCTCCGGCGAAATCACATTGACTTCCACGCCAGCCCAGTCCTGACACCGGTTGTCAACAAGGTAACGTCGGAGC
CGGTGTCGAGGAGGGTCGTCGTGACGGACACGATGCCCTCGATCTTGGCTTCGCGGCCGAGGGACTTGTTCGCGCTGCTTTGAAGCTTGGTCACCTTCTT
GTTGCGCGCTCTCCCACACTTGTCCATTTGCTCCTTGAGCAGGCGCTCGGATTCGCCAGGCGCGGAATTGGGGCAGTTTACCACCTTGTTGTTCTCGCTG
CCGCACTTGAGGCAGGTCGCCTTCTTTCGCTCGTACTTCGGGCTATCTTGCACCGGGGAGGTCCACTGCTGCAGCCAGGCTTGGATGGCCGCGATGGTGC
TGCGGCTGCCGTCGCAGGCGGTGCCAAAGTCTTCTCGTCTTCCACCGGGTGTTGCGTATCAACTTCTTGCGAAGTCCGATCCAAAGGCAAATCACAAAGA
GAAATCCCCCCCACTTAACCCTAACCTAATCAGACAGCTGCTGGGCAGCCAATAGTATAACTAGCTAATAGGATCACACACAGGATATCCAACCTAATCG
AGCACTTGGATACCTTCTTGGGAGGGGTTCAGGGGTTCTGCGATTGGCAAATTCGCAACACCAGGGCATACAAGTGGGGTACTCGGCGGTATGCACATGC
AGCCAGTCAACGAAACGGTACACGTTGGAGGGCCAGCTGGCGTTGGCAGGCCAAGCGGCTTGATCGCCTTGACCATGATGTGGACAACTGTCGTGCCTTC
TTGGTCCAAGACCCACGCTTGGTCGTCGCGCTCCAAGGCTCGCATCAGGTTGTCAAGCATCTTGCCAATGCGCGAGTTGGCGTCCAGGATTGTCGTGTCG
AACCGGATCGCCGTGGTCAAACGCTTCGTAAGCACATCCCGGTCTTGAGGCTCCTCTTCAAACGCATTACTAAACCATGTGGCCCACCCCGTCTCCGTAA
CGCCACGGTAGTCGCAGTTGGCCATGTCCCACATCGCCACGCGCTTCTTGGTAAAGACGTCCATGCACGCGCTGACAGGGATCACGGGAGTCGGTGTGGG
CGCCGTAAATGGGGTATCTGATTGAAACCGCTGGTCAACAGCTGGTGGATTACGCCAGCGTGGAGAGGCGAACGGGGTAGTGGCTTGACGGCGCAAGGGT
TGGCCGCGTTCGGCTTCTCGGGATCAGGATCGCTCCGTCCCGTTAACAGGGGACTGCGAGCGTTGGTGGTCAGAGTCAATCATTACTTCGGGCGATGAGG
CTAAAGAATTCTTTGTTTTCGCTCCCGTCGTTATCCGGACAGAACCTCTTGCGGAGGCCGAATTAAATTGCAAACTGAGGTCTCTTACTACGAAT