Description :
From Genome Similarity Track
Location :
Scaffold_1:369080- 370563
Transcript NameFunction/comments
Physo_322189glucose transporter, putative

Sequence
1483 bases(100 bases per row)
TACGCGGTGGCCAACTCCCCCGGCAAGGGCGCCGCGAACACCTTCGACGAGGCCAACAAGGCCGCCGCGCGCCTCATCAAGCCCAACGCCATCCTGTACA
CGAGCGCGCTGCTGTCGTGGCTCCAGCCCTTCCAGAGCGGTTGGTCCACCTCGCAGATGAACCTGTCGCAGTACAACGACACGGACCAGTGCAATGCGCG
CCCCGTGGCCGAGGGTACGTGCCTCATGTTCCCGGGCCACACCAAGCTCGAGTGGACGTTCGCCGTGAACGCGTGGATCTTCGGCGCCATGGTGGGCTCG
CTGTGCTGCGGCCACTTCAGCGACAAGTACGGCCGCAAGAAGACGCTCATGGGCAACTGCATCTTCATCATCGTGGGCGGCGTCGTGCAGACCGTCGTGT
CCAACATTTGGATCTTCTCGATCGGCCGCCTCATCGCCGGCCTCGCCTCGGGCACGGCCACCGCCACCATCGGCAGCTACGTGAACGAGCTGTCGCCGCC
GCACATGCGCAACACGCTGGGCCTGGGGCTGCAGATCTTCACGACCATCGGCATCTTGTTCCCGGCCATCGCCTTCTTCTTCGCCAACACGAGCTCCGGC
TGGCGCTACCTGGCGGCCTTTCCCGTCATTCTGGGCGCCGTCTACCTGCTGCTGGCGCCGACCATGTGCGTGGAGAGTCCGGCGTGGCTGCTCACGCAGG
GCCGCACCGACGAGGCCAAGCAGGTCATCGCGCGGCTCTACGGCGAGGAGCACGTGCAGACGGCACTGTCGTGGCTCGAGGTGAGCAAGAAGCCCGAGAC
GGCCGAGGCCGGGCTCGCGGCGCCCCAGAAGGAGTCCATGTTCAACCCGCGCTACCGCCTGCAGCTGCTGGGCGGCATCCTGCTCTCGTGCTCGCAGCAG
CTCTCGGGCATCAACGCCGTCTTCTACTACTCGGGCAGCATCTTCTCGGACGCGGGCATCTCGGACTCGCGCGTGGGCACGCTCATCATCGACTTCATCA
ACATCTTTCCCGCCTTCTTCACGGGCGTGCTGGCCAACCGCTTCGGCGCGCGCATCATGATCCTCTGGGGCCTGGCGGGCATGGTGGTCATGTCCATCGG
TATGACGGTGGCCTTCATCGTGGACGTGTCGGCGCTCTCCATCGTGTTCACGGCGCTGTACGTGATCGTGTTCGGCGTGACGCTCGGGCCGCTCGTGTGG
GTCATGACGGCCGACATCTTCCCGGACTCGATCCGCGCCAGCGCGTCGTCGCTCTGCATCGGCATCAACTGGCTCTGCAACCTCATCGTGGGCGTGTCGT
ACCCGTACATCTCGGACGCGCTCAACGACTACGCGTACGTGCCGTTCGTGGTACTGCTGGCGATCTTCTACCTGCTGGCGCTCAACCTCGTGCCGGAGAC
GTCGGGCAAGTCGGCCGAGGAGATCCAGGCCGAGTACGACTCACGCCGCGAGAAGTAAGGTGCAGTAGCGAGTAAGAGGTGGT