Description :
From Genome Similarity Track
Location :
contig_13:369049- 370612
Transcript NameFunction/comments
g3021.t1hypothetical protein

Sequence
1563 bases(100 bases per row)
TAAATCCCACGGCAGGCTATTCAATACAACAACATCGCTATCGACCACATCACAGTGAAGGACGGCGTTGAACCCGTATCCAAGCTCAACCACGAAGGCG
TCTGGCAAATTCGGCATCGTGTTGATCTTTATCCGAGTGCAAGTTGAAGTGGTACCTGTCACTCTTTCAAAAGTGTGTCCCATGGACGCGCTGCTCGCGA
CGGCGCAGTCGCTGCGCTCGCTCCTGCAGAGGTGAGCGGGGGATACAGTAGCTGCGTAGCGTATCGTAATGGCTAATAACATGGTGGTGCATTGGTCCAT
GGGTAGTGCGGCGCAGGAGCTCGGAGACGATTCACTCTACCGGAACCTCTCACTCCCAACCAGCCAGGACGTGGGCTTCGCTCTGGACCACACGTTCGTG
ATCCGGGCAGGGGTAGAACCATTCCCACGCGTCCGTGGAGCTGCGAGACGTCCATTGCACATGTAGGAACTAGAATAACAAGGTAGAGTGACGTAGAATT
CGTGGAGGTTGCTGATGTTGTTGGTGGTGACAGGGAGAATTGGTACATCATGTCATCGAGCGGCTTCTGGCTCGGAAACGGGCGGAGAATTGGGAGGACG
CCAACGTTTTAACCCTCGGGTATCGGGAAGTGACGCCCGGGGCTACTGGCCACCGAGTGGCGCAGTCCAATGGGGTCATGTGCTACTACCCGAACACTCT
CGTGGCTGCTCTGAAGAAGCCGCTGTGGGAATCTCTGCATCGGCTCATGGGGGACGACCTCCTGACGCACTTGCTATTGAACTACACGATTGTTGTGCAA
CTGAAGGAAGCCTCGCTGTCGTATATGCAGGTAGAGTGCTGTCTGGTTGAGAAGGGGGTTGGATGTGGTGGCTAATGTGGTGCTTTGTGGTGTGCTAGCT
CACTGGAAAGAGTCTTCGACAACAGAAGCGACTGGGCGACGCGACTGCCACTTTAAAGCGAGAAGTGTCGATCAACCACGTGATGTATGCGAGGCATTTC
CGAAAGGATCGAGTGTTCGCGAGCTCCCACGCTCTAGTGAAAGCGTCCAAGACAGGCGAGCCGATTAGTCGGACGGAAGCTTCACGGGTCCTCGGATCCA
TATTCCCAGACACTGCAGGTGGAAAGCGCTTGCCCAAGCGGCTGATTAACCTCATTCCAACGATCCAGGAGATGGTGGCACGATTCAAGGCGTTCAAAGT
TGAGGAACTCGCAAGGAAGTTAATCCCAGTGCACGCTGGGTTTCGTAAGTTCATGGCGGATCATCCAAACATCAAGCGACTGCTTGCGGAGAAAACTGCT
GATGCTGATGCAGAGGCGACATCGAGACCTATCCTGCTTCCAATCGTTCGTAAAGCGCTTGACGACGGATATTCGAGCCAAAGCGAGGTTGTGGCTCCGA
GCTGCGATCGGAAACGTAAGCGGAGGGAGGAAGCTATTGAAATGCTGTCACACGCTTCTGTGGGGACATCGAAAGCTGGTAACGGCATGTCAGCGCCGGT
GGGGAAGAAGACTAAGAAGACAGTGGCCAACCCAGGAGATCGGGTCAGTACGCACTCAACATC