Description :
From Genome Similarity Track
Location :
contig_13:369035- 370599
Transcript NameFunction/comments
g2867.t1hypothetical protein

Sequence
1564 bases(100 bases per row)
CGTGGAGTTGATCTGCACACCCAGCGGTCTCGATATTTGGCAAGGGGGTGGCAAACCTGCAACAGCGTGAAGAGCAGGATTGCTATGTAAATCCCACGGC
AGGCTATTCAATACAACAACATCGCTATCGACCACATCACAGTGAAGGACGGCGTTGAACCCGTATCCAAGCTCAACCACGAAGGCGTCTGGCAAATTCG
GCATCGTGTTGATCTTTATCCGAGTGCAAGTTGAAGTGGTACCTGTCACTCTTTCAAAAGTGTGTCCCATGGACGCGCTGCTCGCGACGGCGCAGTCGCT
GCGCTCGCTCCTGCAGAGGTGAGCGGGGGATACAGTAGCTGCGTAGCGTGCCGTAATGGCTAATAACATGGTGGTGCATTGGTCCATGGGTAGTGCGGCG
CAGGAGCTCGGAGACGATTCACTCTACCGGAACCTCTCACTCCCAACCAGCCAGGACGTGGGCTTCGCTCTGGACCACACGTTCGTGATCCGGGCAGGGG
TAGAACCATTCCCACGCGTCCGTGGAGCTGCGAGACGTCCATTGCACATGTAGGAACTAGAATAACAAGGTAGAGTGACGTAGAATTCGTGGAGGTTGCT
GATGTTGTTGGTGGTGACAGGGAGAATTGGTACATCATGTCATCGAGCGGCTTCTGGCTCGGAAACGGGCGGAGAATTGGGAGGACGCCAACGTTTAGTG
ACGCCCGGGGCTACTGGCCACCGAGTGGCGCAGTCCAATGGGGTCATGTGCTACTACCCGAACACTCTCGTGGCTGCTCTGAAGAAGCCGCTGTGGGAAT
CTCTGCATCGGCTCATGGGGGACGACCTCCTGACGCACTTGCTATTGAACTACACGATTGTTGTGCAACTGAAGGAAGCCTCGCTGTCGTATATGCAGGT
AGAGTGCTGTCTGGTTGAGAAGGGGGTTGGATGTGGTGGCTAATGTGGTGCTTTGTGGTGTGCTAGCTCACTGGAAAGAGTCTTCGACAACAGAAGCGAC
TGGGCGACGCGACTGCCACTTTAAAGCGAGAAGTGTCGATCAACCACGTGATGTATGCGAGGCATTTCCGAAAGGATCGAGTGTTCGCGAGCTCCCACGC
TCTAGTGAAAGCGTCCAAGACAGGCGAGCCGATTAGTCGGACGGAAGCTTCACGGGTCCTCGGATCCATATTCCCAGACACTGCAGGTGGAAAGCGCTTG
CCCAAGCGGCTGATTAACCTCATTCCAACGATCCAGGAGATGGTGGCACGATTCAAGGCGTTCAAAGTTGAAGAGCTCGCAAGGAAGTTAATCCCAGTGC
ACGCTGGGTTTCGTAAGTTCATGGCGGATCATCCAAACATCAAGCGAATGCTTGCGGAGAAAACTGCTGATGCTAATGCAGAGGCGACATCGAGACCTAT
CCTGCTTCCAATCGTTCGTAAAGCGCTTGACGACGGATATTCGAGCCAAAGCGAGGTTGTGGCTCCGAGCTGCGATCGGAAACGTAAGCGGAGGGAGGAA
GCTATTGAAATGCTGTCACACGCTTCTGTGGGGACATCGAAAGCTGGTAACGGCATGTCAGCGC