Description :
From Genome Similarity Track
Location :
Scaffold_40:369016- 370951
Sequence
1935 bases(100 bases per row)
CGCGTCGTCACCACTGATACCACGTCGGTATCAATATTCTTCTGCGGTTGTGTCGCCGCAGCCGTAGCCCCCCCCCACTTAAGGAGGAACTCACCGTTCC
GAGCAAGATCGGAAGGCGTGGATGCCGCATCGCATCCGCGTAAAACTATGTATGCCCTGTAGAGGCAGGCACTGAGTTGATGATGGCAAACTCTGGCATT
GGCAAGCAGTCGCTCCACTGCGGGAACGAGTGTGCGTAGTCGTTCAGTACGTCACAGAGCACGCGATTCACACGCTCGGTCTGTCCGTCCGTGTGCGGAT
AATCAGCAGTCGGCATCAACAGCTGCGCTCCAAGAAGTGTAAACACTTCTTGCCAGAACCGCGCTGTAAAGCGTGGAACATGGTCCGACACAATGTCGAG
CGAATTCCATGGTGTCGGAATATCATGTCAACAAACCGTCATGCCGTCTGCACGGCCGTGACTTTAGCTGGTACTGCAGCAAGATGAACCATCTTGATGA
AACGATCAACAAAGGCCACAATGCCAGTCCTCCGCTTGTTGTCTGACGGAAGACCGATAGCAAAGTCCATAGAAATGGACTGCTAACACTCCGACGGTTT
CGGTAGTAATTGTAGTGGGGCCTGTGAATACACAGCAGGCCTCACACGTTGGCACACTTCACAAGAACGTACGGACTTGCGAAACCACTTGTACTGGTGG
TTCATGTAAACGTACCTCCTGCATGTTCTCCCACGGCCAGGGTGCCCTGCCGTACACGCATCGTGGTACTCGGACAGGATCCGCATACGCAGACCAATAT
TATTCGGCACGCCGATGTGGATTGTATTGTCGTCTACTGCGCTGCAAAGCAGCAGTCCTTCGTCCACACGATATGGGTGTGTACGAGCTCGCTTGATGTG
GCGACAACTTCAGACGTGACACATCGGAAGGTGAAAAGACATTTCTAGCAGTTGTTTTGCGACAGCGTCACTCGAAAACGCCTTGTTCACGTCGTCGATC
AATGTCGACGACGGAGCACTTACTCGTTCAACGTCGATTTGATTGAGGTCGGCTGCCTTAACAGCATAATAATGTTGACGCGACAGCGCGTCGGCCACCG
CATTCAAGCTTCTAGGTTTGTATAAAACCTGGAAGTCGTACTCCGCAAAGAACGAACACCATCTCGTTATTTGCAATATTCGCGGAGTCATCACTCCTGT
TCGCAGTGAAGCGTGGTCGGTGTAGACCACGAACGGTCTACTCCCAAGTAAATACGCTAGGGACTTCGCCAGTGCATACTTCATGGTAAGGAGCGCCTTG
TCATGTACAGAGTAGATACGCTCCGCTGGCTTTAGCTGACGCGACTGGTAGTTGATCACACGATCATAGCCCTCGTGATCGTGCTGCATCAGCGCGCATC
CGATCGCAAAATCAGACGCGTCACATACGATGTGCATCTTGGTCAGCCACTACCAAGATCGGCGCCTCTGCTAAGCCCTCCTTGACGGTATCGAAGGCCT
GCTGACACTTTAAATCCGCTCAGCTTCCTTTTTCAGGAGCTGTGACAGCGGGCAAATCTCGCCTGCGTAATTCTCAACGTACTTGCACAAGTACGTGGCA
AATCCAAGAAACTGCCTCAGCTCCTTCATGTCGGTTGGCGTTGGCCATTCATTGATCACTATGATCTTTTCTGATCAGAGCGTACGCCGTTCTTCCCGAC
GAGACACCCTAGGACAGGTTTCTCGTTCACCCCGAAAATATACTTCTTCAGGTTCGCATAGAGCTTATGTTTACGGATAAGCCAAAGCAGTTGACAGAGG
TGCTCTTTGTGCACCTCAACGTCAGTCTTCTTGTCCACAGCCCGGCTGTGAGCGAACACGTCATCGAAGTATCTCGGTGCGAAGTTACGCACTGAGTGCA
ATATATGTGTAACACATCTATTGAAGGTTGCAGGG