Description :
From Genome Similarity Track
Location :
Scaffold_1405:369- 1504
Transcript NameFunction/comments
Phymu_g13230hypothetical protein

Sequence
1135 bases(100 bases per row)
AGATTCTGCCCCTGAAGAAACCAATGACATGTATTTAGTGGCGTAGCAATCGTTAGCGCATTTCTGCGGGTAGCCATAATTGAtggcgttttcttcttct
ctattTAAAAACAAGAACTTGAAAATCACAAAAATAGTTGTGAGAACCGTTACAAAGATTTTAAATTGTCTAAATGTAGAGGAAGTACAAGTCACTTACC
CCTTCTCTTATTTGTAGTGTAAGCCAATATGTCTCTAAGTAAAAAGGAGTTCGAAGAAGCATTAAGTGCATTTATACGTCAGTATTTCCCTCATGTCAGA
ATCtcaggagaagcagtacgCTTCCTGCGCGCCGAATACAACAGTGTTCCGCCCCTAGGTAACACGCCGATGGTCTTCTTGTTTTCCGCTTTAGGCCgct
tgcttcaacttgaaccgcgtcgtcttgaaggGTCTCACGTCCGTCTGTGGCGCGACGCACgtcatcaagacgacgctgcatTCGCACAGGCAACAGGTGA
GCCCTTGGTAGGTGCACGTGACGCAGTCGGTGAAGCCTCAACGCCTGCCGCCGAAGCACAAGCCACCACCGAAGAGAAGCCGTTTGCCGCTGAAGCACCA
CCCGCTGCTGATGAGAGGCCGTCCACCGCCGAAGGGGCCTctgaagagaagctgcttgtcgcTGAATAAAAGTCACCCACCGCCGAGAATGCCGCCGAAG
GGAAGCCgcttgacgctgaagcgaAGCCAATTACTGCAGCTTTGGAGGCACCcgctgttgaagagaaaCACTCTGCCgaagatgacagcgacgaaggCGT
TGTCTGGATACCTGGTCCTGCTTCCGGTGAGGCGGAGACCGatagcagcgacggcgagaCGGAGTGGCAACCGACGACCAGCCTCGCAGCGCCGCNGTAC
TTTcattgaggacgaagcaggaggtaGTCGCCGATCGccaacaactccagcagatTACAGCAGTAGGCGTCCACTGTGCCGGCTCAGTCGTGGTAGGATT
CCTAAACAGCAAGATAAACAGAGATATCGTAatgtcttcagcttcttgttttACCTTTCACCGAGAGTCCTTCTTATTCTGCTCTTGATTGATATCGCAC
CACACGACAAGGTTAACCAAAGCGGTGCACACTAA