Description :
From Genome Similarity Track
Location :
Scaffold_28:368935- 372233
Transcript NameFunction/comments
Phyra_78058AlNc14C189G8419

Sequence
3298 bases(100 bases per row)
TTATAACGAATCAAGTCAGTCTGTGCGATCTATTTTAACCAATTGTGGGGCCAAATTCGTAAAGGCCCCACAACCACACCTCCGACGTATCGTGTCGGAG
AAAGCAGAGAGTTATTGATATCCCTCTACAGATTGCAAGTCATTCGTATATTCTTAGAATAACACACAAGCTCCGACATCTCCGACCCAACATGAGCCTC
AACGACCTCGCACCGGCCAACACCAAGCGGGCTCGGGAATGCGCAGCACGCTCGTTCCTGAAGTTTCTCGAGGAGGAATCCGTCAGCTGGGAGTACTTGA
GAGTGTGCATGCAGCACGATAGTGCTTCGCTCGTCTTGGAGACTGTGGTAGACAAGTTCGGCATGTACCTCGCCTTCAAGGAAGGGCGCAAGGGCCAGCT
CTTAGCCCGACACTCGGTCATGCAGTACTACCGACAGGCCAAGACCTGGCTGCTGGAACAGTTCCCTCAGCATCGAGCGGGGATCGACAAGATTCTGCTG
AAGAAGGGACAAGTACTGGAACGGTACTGTATGAAGAGAGAGTCGGGGGCGTTTGTAAACAAGGCTCCTGCATGCACGAAGATCGCGCTTAAGCAGATGA
TGGTATATCTCTATTCGACGGCTTATACCTCCGCAGACTACCAGGACGCCGCCTTGCTGTGTCTGCTCTGGTTCCTTTTTGGGCGTGCGTCGGATCTTAC
GATGCTTCGCAAGGCCAACCTGCCCATTGGCGCAGGCGACATCTTCTTCGTGCGCTTCATCCGGGTCAAGACTGCAGAAGAACAAGGCCTCTCGCTCTTT
CCCGACGACGACTTCTCCACATGCCCGCTTCTCGCCATCGCGCTTGCACTGGTGACGCAGTCTTCTCCGACGGCTTCGCTTCTGAGTCAACTTTCGGAGC
CGCAGACAGTCTCCCGAGCGACGCTGACACCCGCTACGTCTCTGATTGACTTGATCGATCACCCGGAAGCTGTGATCCCGCTGCATCAAACGGCCAAGAA
GTCAGATGAGAGCAAGACGGCCGATACAGCACCTGGGATCCACAGCTACATCAATCGCGTTCTGGACAGAGTCGCCAAAAATGCTGGCGTGGCCGAGCGT
CTGACGTCGCATTCCTTTCGGCGGGGCGGAGCTCAGCATGCAAATGGAGCTGGAATGTGCGTACAGTGGATTTTCGACCGTGGAGCGTGGAACATGACGG
CGACGAACAAAGCCTTCTCGTACGTCTTCAACATTCCTGCCGAGGACCACAGGGTTGCACGAGTCTTGAGCGGCCGTGACCCCGAACAAAGAGTTCGCCT
TCTGACGCTGGACTGCTTCGATTCCGATACCCAGTCCAAGATCCAGTCCGTAGCGGCAGCACTCTTCAACGCTTCGTCCGGGCTGGAGTCGCCACCGTAC
AACGTGAACGTGCGCGTCATCGACACCTTCATGGTGTATCTGCTGCGGCACTATCCGTCCTTGAAAAGTCTCAGCACTGACGGACTGGAGATTCAACGCA
TCGAGGCTTGCGCAGTTGAGAAAGGCTTCTCAGTCAACGATCTGCTGGCGTGGTCGTCGTTCCTGTCCTCGAACGCAACGACAACATCTGAAGCAAAACA
TACAACCACCCAAGACACCACGGTAGCTATCACAAAGCACTCCATGTTTCTTGAACAAGCAGCCTTGATTGAACAATTAATTCAAGTGAACCAAAAGCTG
GATACTCGTCTGTCTATCGTGGAGGCTAAGATACACAACAAACAACAACAAGCTCCGTCAGCAATGATTTCAAATGAAGATATAAGCAACAACGATCCTC
AAACCAAGCGTCGGCGTACCTCTGCTGCTACCAACCTGAAAGATGCTTGGTTTTCTTGGTACGCTCAAGAACCGCGGATGTGGAGCTCAACGGATGCAGC
GACCAAGCACATGCGGTCGAACGCCAAGTTGATCGTCGCATTCTTGAAGCTGTTTCTTCGAGATGGCTTCGAGCTCGATAAGAAATCACCGCGGTATCGA
GACGAGATCCTGAAAGTTGGTGCCAGCGCGGAGACACAGTTGCTGTTGTATCTCCGCGAGCACAAGATCACAGCTCGTGGGGCCCAAAACGTCTTGAAGT
CGATGCGCAAGCTGCACAAGTCTGGTCACCTCAACGAACACGTCCGCCATTACAAGCAACTTCAAGCCGGCGGCCGCGTAGTTGACCCTGCTCCTTCGCA
CACCACCAACATACTAGGTTTAGTTTAAGCACGTGGTTGCATACAGACTTACCTTTTGTCGCCGCAACCAGTCGTTGCTGTTCATGATTATCGCTTGGAG
AGCCCTGAAGCCCACTCTCCGTTCTGCACCCGAACCAGCGAAGCATCCGCCATGCCTTCAACAAAGCCCAAGAAAAACGACATCAGCTCCGCGAAGGAGT
TCAAGACGCTATGCATCGCTGCTCGCAAGGCGTACAAGATCCGGGTTAGTGATGAGGCAATCCGTCACCTTCGACTTACCATGAACACGACGGTTGCCTC
CGCGAGCCTCCTCCCCGAAGCGATTGATGTCATCTTCGCTTGCGTGTCCGAACGGAAGAAGCGGTGCGTCGGCACTGACGACGTGCGTGAGTGGCTAGCA
GCTCCTGGTCCAGGTGGTGACGATGGATCGAGCGACGAGGATGAGCGGAGCGCTGAAGAAGACCTGACAGCAGAGAAGCTCCACTACGTCCGCAAGCTGC
TGAATTGGAAGCGTGAGAAGCGGCAGACGTACTACCTCGTCGAGTGGGAGGCGACGTGGGAACCTCGAGAACACCTGAGCCAGACCGTTGTCGCTGCCTT
CGAAAAAGAGCGCCGCCTTCTTGTTCGCAAGAAGTTCATCGAAGAGGAAGCTGTTGAGGACAACACGATCAACAAAACGGAATGATAGACGAGGTAGCGC
ATAAGGAGTTAATACAGGGTGTATTACGTGCTTTAGAATCAGTAGCAGGGGAAAGACATTGATAGCTCTACATTGAACACTAAGCTTAACCTCCAATTGG
AACAGCAAAGTTAACCTCGTTACAGAGCACTCAAACACACATCTAAGCGCAGCATCAAACACAAAGCTTAATCTCCTTGCGGAACAGCAACGTTAACCTC
GAAGCAGAGTCAGCACGCCTTGCATTGTCAGCAGAGGCGGCTGCCCATTGGCTTGTATACAAACATGCAGTGAACCCAAAGCAAATGCACTGGGTTGTTA
CGGGCACTTGTGCCGGACGAGAGAAAAAAGAGGGAATGCCGAGGGCTGTCGTGCGGCGGCACTTGCGGCAGCCCCAGGCCAGTAGTTCTCAAATAACC