Description :
From Genome Similarity Track
Location :
Scaffold_14:368871- 371104
Transcript NameFunction/comments
Hyaar_Emoy2802658hypothetical protein
Hyaar_Emoy2802659nitrate reductase

Sequence
2233 bases(100 bases per row)
TTGCCTCATTTCGTCGAATAACCGCGCGTCGCCACTCATTATTGGATTTTAATCCGCACAACGCTCAACGAGAGGAAGAAATCCGCCCCCTTTTCCTCCT
CCCAACCTCCTGCTCATCATGTCCGACGACAAGTCGCCGTCAGCACCCACGTCCCCCAATGGCACTCCCACTCCCCCGATCAAGAGCAGCAACAGCAGCA
CCGACTTGGCCCAGCAGCAGCAGCAGACGCTCCTCCAGCAGCAGCTCCAGCAGCAGCAGCTCCAGCTCCTCCAGCTCCAACAGCAGCAGCTCCAGAGTCT
CAGCCAGAACATGAGCGCCAGTGAACTCACGGCGCTGCAGCACCAGCAGCAGCAACTGGCGCTCTTTATGATGCCCATGTTCCCGCTCATGATGCCGCCT
CTCCAGCAGCTGCCAAATGCTGTCTCTTCAGCAACGCATGAGACGTTATTGACTGCTGCCGAAGCTGCTACTGCTTCGGATCAAGCAGCAGCCGAAGCGG
CTGAAGCTGCTGCCGATGCTGCGGTGGCTGCTGCCCATAGTGAAGTGCTGCCGAGTTATTCACCGGCAAGTGCCGAGTCGTTGGGGCTCGCGTCGTCCTT
TGGGAGCTCGGACGCCTTTGGGCTGTTACCAGGGACGACGCTTCCGTCTGCAGCTGCTGCTGGTTTAAACCTTGATGACGTGCCGAAGCGGAAACGCGGT
CGACCACCGAAAAAAGATGTGGCGGCACGAGCCAAAGGGGACGTGGAGAAAGCACTCAAACAGCAGCAGCAACAGCAGATGCCATTATGGGGCTACGGTC
TTCCGATGCCGCTCTTGCCAGGGTTTCCACCGGGCATGCTCTCGGGCATGTCGAATCCAGGAGCTGTGGTGATGAAGGGGGACCATGCTACTTGTGAAGA
CGAGCTGGAGCAAGAGGGAGACGCCGAGCGGCCATCCAAGACGGCCAAGAAAAAACAGCGAGGGACAGGCAAACCACGGGGTCGACCCCGCACGCGGCCA
CGTCCAGGTGAGATCATTCGTCGGGTCAAGCCCCTTCCGATTGCACCGGCAAACTTTTCCGTCATGTACAACTATTCGCTCTCGAATTTAGCGCACAAGA
GCGCGGAACTTAATGGGGATGGCAGCGTAGCGGACACGGACGCTACGACGGGCACAGATGAAGCACAGGACCGGGGATTGGCGTCGCTCAGTGCGTCGCT
GCTGTCTGGCGAGCACGAGTAACGAGCTGCGGTATAATACATTACTTCTTCATTTGAGAACCCCCAGTGTTTGGTCCGTCACGACTGCTTTTGACGAAGC
ACGTACATTGTTTGCAGTGAAGACAGTCGATACTTTAGGAAGCTCGAGCACCCGATGACACCGTAGTCGCCCTGCTCGTCCATGCTCGAGCTTCCTTCGT
GGTTATATTCCTCCTCCTGGCGTCTATCTGTCTATCTCGTCACCACCACCACCTTTGCAGCTGTCTGTGTGCTCTAGAAGAACACTTCTTCGTCCCCTTC
CTGGCTAACAGCGTCACTGTCGTAATAGTCGTACGTGTAGTCGTTCATGTCGTCGCCCAGATCCTCTTCTGCTTCGTCTATCATGCCATCCTCGGCTTCC
TGCTCGCTCGCCTTGGCCTTATCAGCTGCAATCTTCTTCTCCTGTGCTTCGAGCGTTTTAAACACTGTTTCAAACGCACGCGGCTGCACAATGCCGCGAT
GCATCGAGCCTCTTGCTGCTGCTGTGCGCGACCCACTGAGCGAATTGCCCTGCAGTTCCTCTGGCACGTACACTTCATTAGCTTTCTGTGTCTCAGGCAC
AGTCACGTGCACAAAAGCTGCAGAGTCCGACGTCTGTTTCCGTCCAGCAGCGTCCGAGCTGGAAGCTTCGGCTTCCCACGGATGATGGTACAAACCCTCG
AGTTTGTGAGCCAAGAGACGCTGTCTCTGGATCAAATAGGCTTCACTATCAGTCAGCGCCTCTGGCTGAGGCAATTCCAATGGTGGGTACAACGCCGTGC
CTTCTTCCGCCTAAAAAAAACAGTATAAAACACCGTGAGCTGTTTTTTTCAAGTTCAGAACAGGATTCGAAAAAAACATGTTTTTTATTCGACAGGCGCG
GACGTACGTGAAGCAGCTCCATCTGCGCGTACGAGAGCCCCAGATCCTCGCGTGTCTCATCCATGATGTCGGCTAACATCGAGTCCCGACTGCCGCCGAA
GCGTACGCGACCACGACCGCGTCCTCGACTCAT