Description :
From Genome Similarity Track
Location :
Scaffold_337:3688- 8347
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_337-snap-gene-0.6Protein kinase

Sequence
4659 bases(100 bases per row)
GATAGCGACATGGTGGGTCGACTGTACAAGATCTGGAGTTCAGGGGGGAGCATGGACCCGCTTCCGATCGCGGAGAAAGCACTGCCGCAGGTCGTGAAAA
ATCGGCTCGTGCAATTCGACTCACTGCGGTGGGGCGTGCTTCCAGGACTCGTCCAGCGCGCGATATTGTGGGACACAGGGATCGTGATGACGTCCAGTTC
AGAATACGTGCAGATTTTGACAGTGTGCGGCCAGACGATGGCTGATTTGATGCTCGATGTTGCCGTGGTGCAGGATATCGTGAGTAATAGCAGCACATGT
GTGCTGTCGAAGTGCGGGGGTAATGCACAATTTCTGGAGAGCTGTTTAACCGATATCATCGTGCCGAACGTGCGCTGTTTCGTTGATAAAACAACGTTGG
GGACAGTGCCGTCATTTTCAGGTGTGTACTGGGCAGCAGACGGTGGCAATGAGGAAGCTCCTGCTCCAGTCTTGCGGGATCACACAAGTCTAAACACGTC
CGTGAATAAGCTGTATGCGATTCACCTCGTTGACAAAGTGTTCAGTGGCGTGAGGTCGTGTGAAACAGAGGCGAGAATGATCATTCCGTGTGGAGAAGGA
AACCAGAATGATGGACGCATCTGCACTCCGTCAAATGGTGCGACGCTGGACGCGTGGCTCAAGTATCTCTCCATGCCCAACCAAAGTACATTTACGACGA
CGTCCTCAGTGCTGCTGATCATTCTGTTCCTTCTGATCGTGGCGCTCTGCGCGTTGATTTATTACCTCGTCAGGTACAAGGTGGATTTCAAGTCGCTGGA
CTCGTACGATAACTCGCACACTTCGAACCTGCTATCCAACGAAAACATGCTGAATGGATCCACGCCGATGGACGTGTTTGCTCGCGCTGGCGGCCGTGGC
AGTCGTGGCGCTGATCCGACGCTGTCGAATGACGCGCTCTGCAACAAGTCTGCGATCTTGCGCCGCTTCGTCTCGGATCCGACTATCGTCACGAAGCGTA
TTTCGGTCTCCCAGCTTACGTTCCTGCGTGTCTTGTCGAAGGGTGGAAACGGTGAAGTCTGGTTGGGTCAATACGAGTCTCGGTATGTCGCGTTGAAGTG
CCTGCTGGCGTCCAAACGGGACGATATATCGTCGCTTGAACGCTTTAGCGATGAACTTCGACTTGCCTCAGTGCTGGAGCATCCAAGAATCGTGGCATTC
TGTGGAGTTGCCTGGCAATCGCTACTTCATTTGTGCGCAGTAACAGAGTACATGGAGCGAGGAGATCTGGAAACAGTGTTGAGCCACCCGACGGCCACTT
CTATGATGTGGGGCAAGGAGAAGCTGCCAATGGCGATGGATATAGCTGAAGCGTTAGTGTACCTGCATTCGCTGGAGCCTGTGGTGATCCATCGCGATTT
AAAATCCAAGAACATTCTTCTTGATCGTCGTCTGCGCGCGAAACTGAGTGATTTCGGACTCAGTCGAGAAACGTCTGTGGAAGACACCATGACGAATGGC
GTTGGTACGATTCTCTGGAGCGCTCCAGAGGTTCTTGAGGGCAAACGCTACGATGAGAAAGCAGATATCTTTTCGTATGGCATCGTGCTATCGGAAATTG
ATACGTGCATGCTTCCGTACGGCTTCAACAAAGAGCGTGGTGGTAAGAACAAGATGAAGAGCATGCAGATCGTGCATCTTGTGGCAGAGGGTAAATTGCT
CCCAACCTTCCGCGAAGATTGTCCTCCTGAGATCGTTGATCTTGCACGAGATTGCTTGGAGCTGAACCCAGAGAAGCGCCCGACTGCGATGGAAGTGGTG
TTCCGGCTGCGCTCGAAAGTGTTGCCACTGCTGAACAACGGAGCGTTTGACGAAGAATAGAGAGGCAGGTGACACGATTATCTATTTTATTTGTATGTAT
TGCTATTGCTCGTATGTTCAGGGAGTTTATAGCAATGGCGATCGCCCACCCATCGTATGTTTCCATATCAAGGATCGTCTAGTAAAGTAAAGCAAGAAGA
AAAGAAAGCCACAGGCAGTGTGTTTGAGTTGTCGTTCCGTATCAATGTAATCTAACGGTTTTATTTTGCTCCATCGCATCTCACGTCCGCAGTTCCCGAG
TCCGATCAAACGCAAATACCATTTTTATACTCGGCGCCTGCCTGATGCGATCGATCGTCACCTGGATGCCTCAACGAGTGAGCGCCAAGCGTGTCCAATG
AGCTCTTCCGTTACACCAACCGAGCAGCAGCCGCCAGCGCGCATGATAAATACGAAGGTGCCTCATGCGTCAACACTCCCAACATCAACTAGTCCTCGTG
CCATGGCCTCTGCTGGCGAAAAAGGCAACCCCGACGTCGAACGGAAACGGAAGCTCATCCAGTCGATTCCGATTCTGAACCAGGCAGTCAAGGGCCAGCA
TTGCGGCGAGGACGATCTTATTTTTGCGCTGAAGATTACAACGTTCACTGACGGCGAGTATGTGTACTGCCAGGGACAGACAGAGCGCGAGGTGTATTTC
ATCGAAGAAGGAAAGGTGCTGATTACACAACGCAGAGTTGGAACAGGTCCTGCGCGTTTAGGTGCGCGACGGCGATCCATGCTAGAAGCAGAGCTGGAGA
TTCAGATCACAGCCCACGAGGTGCACGGATATTTCGGCGAGATGGCACTGCTGCAGAATGCTCCGCGAAAATCGAATGCTGTGACGAGTGGCGCTGTCAC
TTGTATGGTACTGCACGCCGACGATTTCCAATCGCTCCTGGGGTCACTGCACCAGTTGATGCTGTACCGCAATCTCCTGCGTTCGCACTCCGTGCTGGAG
AAGCATCGATTGTTCAAGGAGTTCACCCACAGTCAACAGAAGCACATGATCAACCATTGCAGTCTCTCCACGTTCCAAAACGACGACTATATTTGCCGCC
AGGGCGATATGGATGATCGATATTTCATTTTGGCAGAAGGCGAAGCGAATGTTGTCATCGACGAATCCCTCCCAGATTCGACCCATTCGCGATCGAACTC
TTTGTTTGTTGGGGAGCTTGGGAGGCAAAGCAGTGCGATCAAAAGTGTGAAACGAGGCGACGGACGAGGTGGCCAAATCAGGTCATCGACGGTCGCTCAT
AAGTCGCTGTTCCAGGGCTTTGGAGAAATGGGTTTGCTGGATAAGCCGCGAACTGCTCACGTACTGGCAAAAGGCAATCCTGTGGTGTGCGTTGTCATAA
CTCGTAAGGATTACATTGCTGCAAGTCAGCTCTCAAATGCGGTAATCGACGTGGACGCTGAATCGTTGTTGGCGACGACGCTGATAGAAGAATGGAACCT
CGTCATCAACGCTCGCAATTTGCATCTCTCAAACCCTCAAGTGTCACATTACTTGATCACATTCATTAAGAAGTTCAAGGCTGCTTACAATCAGAAGTTT
GTTGGAAAGACCATGTACCTCGATTTCCTGCGACGACTGAATCAGGAGCCACAACTTGGGGACGAGTTTGAGTTCGTATCGTCACGAATCGCGTGGGACT
CACCAAGTTCATCTCTCAGTATCATTCGGTCGGAAACACGGCGCATTCTCTCGGCGCCGCCGTCCGTGCGGAGTCNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGTTTTGTTGGTCGAATGATTGAAAACACGTTCTTCTTGAACAAGTTCCAGATGCCGTCAAATGTCGACAAGCACAAAGTGGCTCGGCACCTCGG
GAGGTTGATGGAATTCCTGAACATCGGTAAAGACATGTACTTGTTTCGTCAGGGCAAAATCGAGAGCAAAGCGTTCATGATTCTTCGCGGTAAGATCAAC
ATTGTGAATGAAGATGTCAACTCGCTGCAAACGGTCAAGCATTACGAGGTTATCGCAACGCTTTCTGCAGGGGACTCGTTTGGCGAAATGTCCCTTGTGA
CCCGATTGCAGCGCTCGGCTACAGCGATGGCGTCTTGTGATACTGACTTGCTCGTGCTCGATCGAGATCGGTTGCACATGCTGATGGCAGCTTTACCAGG
AGTGCAGGTTCGGCACGAAATGGTTCAGCGTGCCGAGTTATTATCGAAGCTGGATTTTTTTCGAGGCTGCGACTTTGGACAGTGCATTCGTGTTGCCCAT
GACATGCAGGAAGTTGTCTACGAGCCGCATCATTTGTTTCTCAAGGAAGCAGTTCATTTAAGGACATTGTACATCGTCAAGAGTGGCGAAATCGCGGTGT
TTCTCAAGAAGATAGTTCCAGCAACGACCTTCCCAACATTAAATATGGCAGCATCAAGTTCGCTTCCAGTATCAGCATCAGCTACAATACCGACGAAGAC
GGTGCTCATCAGAGTAGCGACAATTGGTCCCCAGGAGTTTTTTGGCGTCACGATAGCTTTTGCTAACATCAGTGGGGCTGCAGTAGCTCCGAGTAATGCT
ACAGTCGGTGGAAATAGTGCTAATGCAAGCAACCCAGGGATTCATGCTTCACATTCCGCAAGCGGGCCAACGGTGTTGGCAGTGAGCAGCTCCTCCTCTT
CGGTAGCAACAAGTCAAGCTGAATTGGCGTCGACGGTCTTCATGTGCTGCACGCGAGTTGAAATTCTTGAGCTTTCGGAACGTGGCTGGAGGCGATTGAC
ACCGCAAAGCCTGCAGACAATTCGGAGTTCGTTGTTGGAGCGTAATCGCTGGAACCATG