Description :
From Genome Similarity Track
Location :
Scaffold_1528:3688- 6035
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1528-fgenesh-gene-0.0Phosphatidylinositide phosphatase SAC1
Pytiw_DAOMBR242034maker-piw_contig_1528-fgenesh-gene-0.1Conserved gene of unknown function

Sequence
2347 bases(100 bases per row)
CGGGATCGAGCCGCGGATCTGCACGTACGAGCAGACCGAACGGTTGGGCTTGACGAGCACCATCTCGGTCTCGGCAAAGTTCGCGACGAAGCCGTCCTTA
TCCACGCCGCGCACGTTGAAGCGCGTGCCGACGCGGCGCCAGCTGCGGCGCGTGAAGAAGAGCAGGTCGCAGCGCATGCCGTTGATCTCGCACTTCTTCA
TGACCTTGACGAAGCCGCTGACGGCGGGGATGATCCAGTTGTGCAGGTCCATCTCGATGAACTTTGTCAGCAGCGGCTTGTTCCAGAAGAAGTCCTCCTC
GGCCTTCTGCCACATGGGCAGCTTCTGGCTGTTGGACGACGCTGAGTTGTTCGCGCGCCGCTGGGCCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACGAGAAGTAGAACGTGCGACTCGCCACGACGGACTTGA
GCATGCGCACGTACTCCTCCTCGTCCTTCTTCTCGCGCTTCGAGGCGTGCTTGAAGAAGCTCCGGTGGGCCGCAGCCGACACGGGGATGAGCTCGAGCTC
GAGGATGCAGTAGATCTTCTCGCTGTTGGGGCCCGAACCGATGACGCGCGAGTCCTGGACGACGGCCAGGTACGGCCCGCTCAGTAGCGAGTAGACGCCG
TAGACCGCGTGGATGGGCGTGAAGTTGGCGTCCTGCTTCTCATCGGGCACGTTGGCGATCTTCTCGATCTCGACGCCTGGCGCACCGTGCTCGCGCGTCT
GGTGGGCGCTCAGCGACACGCGCAGCCAGCCATTGGCGCCGGCGCGGCAGTCTTCAAGCAGCAGCTCTGAGTTCTCCACGTGCACCTTGAACATTGCGAA
TGAGCTGCTCGTGCGTGGGCTGTTTCTAAGTGAGGGCGGCGTCTGTTGCGCGTGCGAGTGGCTGGATACTGCAGCTGCAGGCACGTAGCAGGAGACGAAT
GTAGCGCTGGGCTGCTGGGCGTAAACAAGGGGCGACGAGCGGCGCTTGCTCCGGTCTTACGAAGAGCTCCTGGTCTATTCGCGTGATGCAAGAATGCAGA
CTGATGACGGCAAAAGCAACCAGGGGGTCGGCTGTATTGACTACCGAGTAGTCGTTTCTCGAGGTTAGACATGTAATCCACCCACCACCCAATCACCCAG
GAATCACTTGGAATGTGTATGCGTGACGCAATCAACAGAGCCAGGAGAGAATGACTACTGGGAAGTCATGTACGCGACACCGAATGGCTCTATTTCTGGG
ACAAGCGACGCGCCGGGTTTGGAAAAAAAAATGTACGGACCGACGTGCATTTGCGGCTCTATTCTTACGGGTAAGAAGCGCCTGCGTCTGTGTCTGTGTG
AGAGAAGAGCGAGCGAAGACGCACGAGGTCCATGCTGCTGCGTAGCTCTTCGCGCTACCGCTTCGCTTCCGTTGCGATCATTAGAGAGAGAGAGAGAGAG
AGTCAGGACGCGACACTGCGGCGTTTGGAAAGTGGCACTTGGATCCACATTTCACACATTAGAAATCCACACACGACAACAACAAATCCATGACGCTCTG
TTCAAGCGTGTCGATCGAGGATACTTGTACGTTGCTTGTATGAGAGTTCTTGGTGCATTACCTTTTAAATTACATGAGCGCAATGAGGTATTTGTTTGTT
TCTTCTTCGTCTTGGTGGTCTTCTATGGAGCGCAAGCCATAGCGAACGCAGCTGAGTGTCGAGTTCGCTGCTTGAGAATTTGTCTGCTATGCCTGCTGCC
TTAAATGGAATGCTCACCTGGATGGTATCTCCGATGGGCTGAAGCTGACGCGCTGGTGCGTGGTCAAAAAGAAGCGGCCGGGAGTCCACGTTCCATCGGA
AGTGGTGGAGGTTGCTGGTGCTTCAAGTCCTGGCTAATAGTAGAGTGCTGGCTTTTTTTCTTGGCTTGAGAGGCTGTACGCTTCGCTTCATCTAGGCTCG
CGTCTTCAGGAACCGGCGCTTCCGTGCGCCGAACGACTTGACGCTTCGTTCAGTGTTGTCAAAGGCTGCTGCGTCAGCCTTGGACCGGGACAGCTTCTTC
ACCTTGTGTGCTCGTGCTTGCTCAGGCGCGATGACTTGCAGGTTGGGTAGCTGGCTCATGTAAGGTGTGTTGGCAGCCGAACGACGCAGCACCTCAGCGA
ACGTCTGCACCTTCTCGCCTTCCATGTCGACGACTTCCCACTCGTCC