Description :
From Genome Similarity Track
Location :
Scaffold_55:36876- 41464
Transcript NameFunction/comments
Hyaar_Emoy2806750hypothetical protein

Sequence
4588 bases(100 bases per row)
TCAAATCAAAGGGCATCCATAACCACTCAAACAATCAGGACGATGTGATCAATGCGGAAACTGTCTTCGCGCTTCAGTCATCTCAACCACCCAAAATTAT
CTTTCCACTTCAAGAGAACACTCTCACATAGCTTCATCCATGTCCTGCAGTAATTCACTAATCAGAGGCATAGGGTATACTATTAAGTATTGTCAACTGG
TTCACCCGCCATTAATCAGTACACAACCTTATGTCTTCGCCGTTCTTCTTGACAATCACCACGGTTGGCGAAGCCCATGGTGAGATGGATGGTCGTCTAA
TCTTGGCTGATAACAATTTTTTGAACAGATCGGCAACCTTCTCTCGGAATTATGGTAATACAGGTCATAAAATTTGAGCTATTGGATTAGCCTCTCCTAC
ATCAATAATACAATTTCTCCATGCGCCGCAGGAGTTAGGGAATTACCTTTTTCAACGAGGAAATCATGGCTTTTCCAACTTGACTGTCATAACTTCTCCT
GACCGTCAGTCAGTGGCACGACTGGATCACCGACATAAATATTGTCAATCGTTATCTCTTTCGTAGGTGTCACAACTTCTGGTAGAACTGCCATATACTG
ATCGAAATCTTCAGCAAATACCTCGCCTCCTTCATGGTAATATACCGATGTGACAGTTCGTCCTTGTTTCTTCATTTCCACGCCAATCGCAGCATCATCA
GACTTCTTAAGCGGTCGATCAGGCCTTTCTTGCAGCTCACCATCATTGATAGAGATTGCTTCTAAATAATGGCTGGACTGATCTCGTAGCGGATTAGCTA
CCCCATGACCAATTTCTTCAATCGCGATTGTCTTGTTTAGTTCGACCATTTCACTTGATTGACTCTGCTCTGGTTCGACGCCTGAAATCTCCTGGATAGT
ATTGATAGCAAACAGTGTATCTGTTGCTTGTTGATCTTATATAACGTACGCTGACCTTTGTCATAGATTTGATCTTAGATACAGCCCTTCTTATAAATTG
CGCAGCTTAATCTCGAAGTACTCTTCCCCAATTCTGCTATTTCTTCCTTTGATTTTACTTCGGTTGGATTAAATTTATTAGTCAGTGTACTATACGGAGG
GTTATCAACTAGCGGTCTGGTAGGCTTCAACAGTGATATCTCCTCATGATCAGTAGTTGCTTAATAGACAACATTCTGCCACTCATTATACATTCGCGAT
TCAACCAAAACGTATACTGGCGATCTGGGTATCATGTCGGCAACCATTTACCAACCCTAAATAATTCCAGGGTTTATATTAAGCTTTAGATCCACGATAT
TGTTAAGCTGCAAGTATTTAATTTTGCCTGGTTCTGTAGTTACTGTTGGTACCCAATTTTAATCCCGTCTCAACCATACATTGGCCTTGGGCGCAACCAT
ACCGATACGTGCTTCCGTCTGTACACATACTGGTATTTCACGTACTGATCATGCCCCATTGTGATCGGTTGCATTGTCGATCGATGTGTAGGTCTCCGGC
CAGCTAGGAGGAATTTTACTCCATCTGGTAATCAAAGAGATACATCCGCTTGACCCAAGCGTACCCCTGCAAACACCGTAAAATCTGTACCTAAAATATT
TTCTGGCCAGCTTGATCTCCTACCTAGGCGTCGAGATACCAGCGACCCGGTCAACGTGATCTTGATCTTGGTTCGTCCCACGGTCGTGTATAGATTCTCG
CCTATTCACACGCACTCTTGCTTCTGATTCGTCGATGACGCAAACTACCTTTCGAGCAAAGGTAATGTCGACAAGTAAGACTTCAGCTGGCCTATTTGGT
GTTGATCTTGCCCATTGCATTGGATTGCTTGAACCATTTTTGAGGGGTGTGATACTTTCACTTTCAATATCCACGTTATTCACCCAGGCCAACTCAATTT
CCATCTCGGTGAACGATCTCACATACTCATCCCCTCATTTAACACTTGATATGGAACGCAAACAATTTAGGGTCGGAATCCCGTGTTTTAGCAATCAGAT
TGATGTGCCTGTACACGTCTTCATCTTTCTTGCAACAAATATATTAATCGCAGAGACCAGAACGCTCAGCTCGTGCCAAATTCCAAACTTTAGAGCTTCC
TAGTTTAACATCTCTTCCACATTAGGCGGAAACATTCCAACATGATTGGTGAGAACGTATCACTTGCGAATACCTTGTAGAATACTTCAATCGGGAATAT
ATCACTATAATTTACCTCTCCGCAAGCCGCAAACGCATAAAAACACTTATCCAATGGGTGTCACTTGTGACCACTTTTGAAAGATTAATCTCTTCCGTTA
CCCTCGATCATAGTGTTTAGTGGATCGCAATAAGTACAAGCTCTCGATCGTCCACCGCGATCGCGTTCAGACCCTCGATCAGTATCCGTATGCCAGTTGC
AACGAACTTTGTCCGGTTTTTCTTGATCGGATAAATCTGCCACCCAAACTCGACGCCGATCCATGTTCCCATCCGATCTTCTTGACTCGGATTCCGATCC
GTTCCTTTCATTTTTTTCGCAGATCGCTCGTACCGCTCGAGCTGTCTTTGACGTATTCGAATTCGGAGATATGATCGCCCACTAATGAAACTCGCTCGAA
CCCATCAACGCTTTCATCTGGCGGGAAACATCCCTTGGTAAGCATGCAAAGTGTCCTCCATCTCATCAGAGTCCGTCAATCTCAGTAGAGTCAGTTGTTT
GGCCAGATCGCGATCATCTAGCGTACCAATAGAACTGTTCCACATGCTCACGACGTGTGCCGGTATAGCTAATTTCCATTGACGGGTCGCGATCTTGGCC
TGGATTGCTACTACATTGAGGCAATGCATATATTACAACAGGGTTTCGTCTGCTCTCTTCCGTGCGTGATAATATTGTCTGGCTGCTAACACACCCTGTC
CCCCATACTGTACCAGAAAACAATACAGCAACGGCTCCCATTTACGCCGTGTATACCGACCCAGCTGTACAAATTCGGCACAGCTCGCATCAACAGATCA
CCGAACTCCAAGCAATTTTATTCTTCTGACGCTTGATTCCGCAAGAACGCCAACTTGACTTTGCTGATCCAGCTTCTAGCCCGATCTCCATCTCGGTCTT
TACCGCTGCATTCCTTCAGCTCCATCATTGCCAACACACGCGTATTCTAAGGAATTGCACCACCATTCTCCAAAGTTTCAGTTGTGACTACTGACCCACG
TTTCCAATCCTACTGTCCTGGATCGTCAGTATCGACATCTTCAGGATCGTAAAGGTCAGAAACAACTGAGGTGCAATCCAATCGATTTAATCTCAATATC
TTGGATGTATGCTTCTTGAAATCTTTCAGACTTGATTGTTTGACCTGGATGATCGCTTGACAGGCGTTATATCGTCTTTAGTGTTGGAACCGTCCCATGA
CTGCGTCGTAGTAAGGCTACAAAGTCCTTGGGCAGGAATTGCATATCCGTTAGCTCGTACAGCCGTCTATTGCGATTAAGTATTGATCGTCTCTACCCGA
TCTCTCGTATATACCGCTCCACTTGGACCCGAGGACATACAATGAATGCCAATTAAGTCGTCCGACTAAACTTCGGATTCAGCTGAGACATACTGCGACG
ACCCGGTGTAGTATCTTGGGATATCTGCAATCTCCGTGTCACTTGATCCATGAATATACATTTGCCTGCTAGAGAATTTAGTTTGTCATATAGCGATCGA
AACGCGTAGATACTTGACTCTATTTACACTCCAACAGATGTTTTTACGTCAAATGCATCCGCAACAAATCTAGACTCACGTAGAGCCGAATGATTCCATT
GATACCTTCCAGTATGTTCATCGCTGCAGCTGGAGCTGATACAGGACCTCGAATCGTGCTGCTCAACTAGAGTAATATGATAAGTAGAACTGGATCATTT
AAAACAGATTTTTCAGAGTCTTTCAGGGACACACTTTCGCCAGCATGTTCAGTTGCCAATTTTCCATCTTCACGTTGTCCTCCTCAAACTTGACTGGTCG
AATAAACGATCTTGTGGCGCGACCGTGTTTATCCGATCTTAGCGTTTCTTTCTTCTTTACTCGTTCCGTCTTCAGATCCTTTGTCTTCAAACTTATTGGG
GTGATCTTGGATTAGTATCTTTTGGTTTCATCCGAAGGGTTTTCACATAGCAAATTACGCTTTGCAGAAAAATTCGCGGTAGTCCCTGAATGAGCCTATA
GCAGGAGGCTTGAGTTTTCTCTTTCATATCGTGCAATCGATATCCCGCTATAATTTTCTCGTCATCAGATCCCTTTTAAAATTCTGACAATCCGGGGATA
TTTCAGAATTACGCGTCTGCTGCAATCCCTATGCTTTTAACGCTTCCATCCAAGATTTAATATACATCTTCTCATCTTTACTCAGGTACTCACAATTAAA
TCCGAAGTCACCAGAAGATCCGGGCACGCGCACCGTTATGGCGGATGCAGGATTTCAAAAAAAAAACTGGTGCAATCCCGAGTCCCCACTGGCGCCCAGA
CGACCGAATATCGGAGACGGCACTCCGTTTCCGTGTTTGCTTACCTCCCCACCTTGTGCTCTCGTCCGGAAGGCCGGTTGCTCTTTTC