Description :
From Genome Similarity Track
Location :
Scaffold_10:36872- 39065
Transcript NameFunction/comments
Physo_130052hypothetical protein
Physo_155984PREDICTED: similar to serine/arginine repetitive matrix 1

Sequence
2193 bases(100 bases per row)
GACGCTGCGAATGTATGTAATGGACGCGTCCAACTCGAAGCAAGGCAGCGAGCCGGTAGCAACAGCAGCGCTATCGGACCTGCTGGACCCGACGGCAACC
GACCCGCCATCATTGAGGCGAACTGTGAGCGAAGCGTCCGCGAACAGCGATCATGACGAAGTGCGACAGCTACCAGACATGCAGCGCAAGCGGTCTCTGG
ATCTGCCCACGTACGGCCGCCAGCAGGTCAAGTCGATCACCCGCCTGAACCTGTGAGCGCCTTAACTGTAATACATGTTGTGGCGTTCGTCTACCTACCT
AGGTACTTACTTGGCCACTCCCTGCAGCGGAGACAATTGGCGCTTTGGACCTCAGCGGCAGTGGAGATGCTCAAATGCGCGAAGAAATGCGTACAAATGT
GACGTGGCAACGCCTCCTCTCATGTTTGGCTGTACCACCAAGATACAGCTCATGGGCGGCCGCGCCGGAGTCCCGAGGAGCGCCAAGCGCGCCGGCAAGG
CTGGAGGAAGCTGTCACTATGTGACTCATTCGAGCAAGGCAAAGTCTGCTTGGTGGCGTGCTTCAAATCGTGCTCTCGAATCCTCACGTCTGGATCAGGT
CCGAGTTCTTTCGCTTCGACTCACGAATGCGAAAACAAAGCATGGTGCTGCCCAGGTACATGCCCGGCAAGGTCTGGCCGCCCTCGCCAAAATGGGGCTC
GCGCAAACGCGCGTCTGCGCCCTGCAAGTCTACAGCTACAGCTTTGGCAACAAGCTACGGTATCCTCCATGAAACGAGAAAGAAACTGATACATTAACCG
GCACGCTGCCTTCCTAGCTCGCATCCCGTTTTATTCCTCCGAGATGCTGAGCGAATGGCGACGATAGAGAGGTCAAGAGGACGACGCTTGCTGCCAAGCA
GCGATTAAACCTTCTCGATGGCAGACGGTCGGCGGGTTGGATACGCAATGCGCCTAGGGGCAGGCCTTGCTGCACTCGGCCACGAACTCGCGCTGCTGCG
TGGACAGGCCCCACACGGGCGCGCCCCGGATGAGCAACCGCTGGATGAGCGTCTCCTCCTCGCTGGCGATCCGCGCGAGCGCCTGCTTCTGCTCCTCGGC
GGCGAGCGAGGCCTTCTGCGCCTCCCACTGCTGCATGAGCTGCTGCAGCTTGGTCAGGTCCTGGGGCTCGGCGCGCGCGCCCGGGCTGAACTTGGAGGTG
GCCTCGGAGCGCGTCTTGGCCGAGCCGTAGAAGCCGCCCTGGCCCTCCGAGGGCTGGCCGCCCGAGTACGTGGTCAGCGCGCGCGCGGAGCGAACGCGGC
CCGAGGCGGCGGCGGCGCGGCGGCAGGTCTTGAGCACGGCGGACTGCATGGTGGCTTGGGACGGAGTGGGGGCTTGATACGCAGCTTCTGCACGGACGCG
GTCGAAAGCGGAAATGCGCTGGCGCGGGTGGTGTTGCCGCTGCAACAAGATTCACGGAGCCGGATGGGAGCCGGATGGGGTTTCCATGTACGCTCGCTCG
CACCAGAATTTGGCTGGAAAACACCACCAGACTCGGAACCTGACCTGGAATATCATGTACCTTAAGAACAGATATCTGCACAAGACGGTAACTGTTTTTA
CGACCTCTGTATTTGAATAATGTGGTAGTATTTTGCGAAAGACATGTTGTGCACACTAGGAGCATTTCCGATACTATGTGCTATTTTGGCCGGGACGTGG
ACCAATCACAGGCGAGTGACGCGTCCCTTTGGCGATGCGCAGGCTTGTCTCACGCACACTGGGCCCAAATGGGCAGGAAAAGGGCCGCCAAAAAGGGTGC
AAAAGCCGGCTAATTTTGCTGGGCCAAGGCATCTACCGTGGAATCTTTACTAGACGGATGAAGCTTTAACGCTCCGTAAGAATGCATGACAGAACATCAC
CTATTTTAGAAGAAAGCGCATATTTCCCAGCAATTTTGTTTTCTTAGATACTGTCTGACAAGGCTACGTGACAAGCATCTTTTTTTATATTGCTTGGGTA
ATTGTCACGTGGCCTTGTCGAACAGTATCTAATTTATCTTGCGCCAGCGAGTTCGGTAGTACCTGGCGCTGGTTTGTGAGTCTTACTCCTTTTTCATAGC
AAGTTTTCAAGATAGTTTTAAAAGTAAGCGCCGGCGAATGGTCCGAACTGCTTTTCTCTTGGCGAGTAGCCGCGGGTTGGACCGACAGCGTAC