Description :
From Genome Similarity Track
Location :
Scaffold_7:368706- 373636
Transcript NameFunction/comments
Phypa_INRA-310PPTG_05106hypothetical protein

Sequence
4930 bases(100 bases per row)
AATTATGTGTTGTTGTTGGAGATCATCGCACCACCAGCCTGACCCTCTAGTTCCCTCTATTTAGCAATATAAATCGCCTTGCCTCGTCTTCTACAAAAGC
GCTTATCAACTCTGTTGCTATTGGCAGATGCAGAGCTGATTCGTGCAAATGCGTGGGTTTATAATAATATTATGTAAGTCAACTGATTTACATATTATAT
TATAATATGTGAATCAGTTGATTTACATAGTATAGTATTTTAGTAGTCGTGGTGCGTTTTAGCGCTAAATGTATTAATACATAATACACCTCACATTATT
TTCGCGTCGTCAACCCAAAAATAAATTTGAGCAAATACTGTTATTATCGTTTTGTATGTCAGGCAAAAAGTGTTATGTTTCCAACTAATAAAATAGGGGA
ACTCATGTCTCCGGAAAGGCCGGGGAGCTGTCAATGATCAAGTTTTTCTGTGCACGAGGAAAAATCAATTGATATCCACCTGATCTGCTTCAGCCTTACC
ACCCACGATTGCTTTTCTTCGGTAATAATTGATGTCACGGACGATCGATGCTTCGTGCGCCGTGAACCAGCGCGACTGCGGCACACACACTACACACAGC
GAGATTACCCCAGTTTTATGCGGGGGTGTTCACGCTGTTCGACGACGTAATCCAGATCCTTACATCACGTAATGATCCTGGAAGACGTCAAATTATGTGT
CAGCGTTTGAATCGTACCCGATGCATGTTCCATAGCTGTTCACATTTATTAAAACACGCATGCTTAACCACGCGACAGGTATAACTTTCAGCACATTCTG
TTATTTCCACAATAATGTGTATATCCTCCAGGTCGCCTATCTTCATGTTTAGCTGCTATCAACCAACAAACGGCAAAATTCACGACGGTAGTGGTTCACC
AGAGTGCTCACTAGAATGCATATTTTGATACGTACAAACACACCGCGCCTTCTATCTCGTACGAGTTGCCGGTGTACGTCAACAATCCCGTCTGCTCGTC
CGCCTTAAACACGAACGTGTCATTCGACATCTGGTTTGCCACGATGAGCCAGTCTTCATAAATCGTGAACCCACGAGGTGTTCGACCGCGTGTGCTCTCC
CAACCGAGGGACGTCAGTGTTCCATCTACCTCATTAATCGCGTAGATTGAGATCGAGTTGTGGCCACGGTTCGACACGTACACGAACTTGCCGTTATTCG
AGAGATGGATGTCAGCAACTGTGCTTGTGGTAGTGAAGTTGGCTGGCAGGGTCGTGATGTTCTGAATCGCTAGACTCTCCAACAGAGACGTTTGCGGGTT
GATCTTGTACACACCGACAGTGTTGGAGATCTCGTCCGTGACGTACAGATAGTCTCCATTGGTGCTCAGTACTGAGTGACGTGGTCCAGATCCGGGTGGA
CGGTAGACCGGCTCGAGCTTTTTCAGCGTCCGAGCTGTTGTATCCAGCTCGTATTGCAACAAGGTATCACCTCCAAGATCGAAAGCTACCACGTGGTTGG
AGTTAGGCAACCACCTCGTGCTGTGGATATGACCCGTAGCCTGCTGATCCATGACGACGCGACTTCCATTCGGGAAAGCCTCGTAATACGTTTCGGGTGC
CACGGTTCCGTTCTCATAGAGCGAAAACAGGGAGAGACTTCCAGCGTAGTTAGCGACAGCGATGAAGTCTTCGTTCGGGCTGAGCGTGATGTGAGCTGGG
GAACCGCCCAGCATCTGCTGTGAGTTGAGCAGATCAAGCTTACCGTCGGCGTTCAGTGTCATCGCCGACACGTATCCGATACCCGTCGCACGGTTGAGTG
CGTAGATCACAGGCTTGCCGTCGGATTTCTTGTTGGTCGCTTCTAGGAGATAGGTGGGGTTAAACCCTCCTGGCGCAAAGCTGAGAGGCGTGATCGCCCA
CTGCGTGAGGGATCCGTCAGTGGTATTTAACTTGTACGTGTAGATACCCTTGCTCGTCTCGTTGGTCCAGGTAGCGGCGAATAGGATCGGTTGCGACTCG
CGCTGCTCCCCTTGTTGCATTGTTCCGGCAGTGACACCGAGCATGGCAGACAATATATAAACAAGGTGACCGAGTAGAAGCATCTCGAGTCGGCGATAGG
CTTGGGGGTTGAGGCTTGGACGTTAAATTTGGAAATAGGCATGAATGGAACGCCGGAGCTTTCCAGTTCGAGTTCCTTTTACCAGGACGCTGTTGCTGCT
AAGTAGTTAGATGATGTATGTAGTGTTGACGGGACGGCTTTGCGTATGTTTCAGAAGCCACCTGTTGATTGCGAAAGTTATGACCATGTTGAAAAAACGT
GTTTCAGAGGATCGAGAGTTGGGTATTATTATTATTAGAAAAATTTAATGTCTGGATATATCAACGAAGTTTGCCAGGTTGGTATACATTCCATCAAGCT
TCCACAGAATTTCGATTTAAATAGTATCAACCATCTATCTGCTAGTTTCTGGTAAAATCTGGATCCAGATTTTGATGCAGCTCAACTTGTCTATAGCATT
ACAGCCCCCCCCCCCCCCCCCCCTAAAATCTGGATCCAGATTTTGATGCAGCTCAACTTGTCTATAGCATTACAGCCCCCCTATTCTTGACTTTAAACCA
GCTCACGGACAAATTTATACACCATGGAATGTTCTACTGTTGACCATCGTTGCTGTGCGTCAAAGCCAAAGCGTTGATTATGGGACGTTCAGAACAAAAC
CCTTCTTGCTAAAAGTGTAGCTGTCACACCTGGAAAAACTTGCTGAGGCGAACTAAAATCTCTGGAGAACTAATCTCTTACACTTCCAGAACTCAAACCG
CATTCTTGACCTCGGCTATTGATACCAAGCATTTTATACATGCGTTTTACCTGGCTGTTCCTGAGTGCGATCATCGTATTTGCTTGGACTAACGCGGTTT
TAGGACTAACGGCCGTCAAGGAGAATGTGCCTGAATCCAAATCGTTGCAGCGTTCTACGAATGATAAACAAGATGAGAGTAGTGCCAATAGATCTTTACG
GGGCAAGTTTAAATCGCTTGCTCATAGTGATACTGGCCATGCCGCGGATGACGAAGAAAGAACGACAGCAGTGATACTAGCACACAAGATTCTTTCGGAT
CAAGCGAGGAAAACGAAAGTTCTGGATAAACTTTCCACTTTGGTGGATAAAGGAAAAAAACTGACGAGACTAAATCACTTCAAGATTGACCAGCAGAAGT
TGGACGCATTTCAAGAGGATACCGAATTCTACAGTTTTTTTTACGGGGTATGAACCCTTCCACGGTCAAAAAAGAATATTTCAGGAGGTTTGGACTCGCT
GGAGACGAGTTGGCCGACAAATACAGCACGTACTACAAGAATAAATACCAAAGCCGCTCATCCCTTGAGCCAGCAATTCGAACATCCGAACAGTATTATT
GAGTATACGCTTGCTTTCTTGTAATCTAAACGCGTCAAGGTTGCAAAAGTCGTACTTTTACAGTTAACCACTGCCAAACGAAGAAGTTCATACTTTTACA
TTTAGCTACTGCCAAACAACACTACAGTAAAATAAAACTGTATTACTTGATATGTATTATTAGTATTGGTGTCAAATAAATATATTAATGTTGTAATACA
TATTTATTATAATAGTACTGCAGAAATTTTCATTTTATTGTCTGCGTGAGCTCTGAATTATGGATGAATATCGTTATGGTGCCGACACATATGTTTTCCC
AAGAGCACGCTGGATACACTAGAGAGTGTAATGATCACGAAGTGCTTGTCCCTCGAGATCAAATCGGGTGCCAGGTTAGACTAGTCATTTTATAGTTTTC
GATTAGTCACTGTGATGGTGGCATGCAAGGCCACATTTTGTGGCAGCTCGTCCAACCCGCAACCAGCACACTTGGAGTGAGCTCTGGTGGAGTATAGTGA
AGCAGATCGCGGACAGCACCATGATGTGGGTGTGAACACCGTTCAGCCGTACCATAAAAACACGGGCGGATATTCAGGGATCCAGGTGCTACTGGACTTG
CACTTGGATGCAACCAGAGCATACGCTCAGGGCGGCTCTTCCTGGACTGCCAAGACGACAGGCGAGAGCACTCGTAAGTTATGCTAGATAGCTCAGTTTT
GCTTTTGCAATCTGATCAACAATACCATTTGGTCTTCGCGGGAGTTTCAGCTCCCAAACTGTTGTGGACACGTCGCAAAGTTAACTTTAATTTAAGTGTA
AACAATGAGAACTCACAGCGGGCGTCAATCTCAAGTCGACCACGGTACCAGATCGACGTAGACGACTGGGATGAGCGCTACCTCGACCAGTGAAAACGCA
AAGGCCTCGACAACTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN