Description :
From Genome Similarity Track
Location :
scaffold_185:36870- 38156
Transcript NameFunction/comments
Pl_108084cathepsin B, cysteine protease family C01A, putative

Sequence
1286 bases(100 bases per row)
GAAAACCCGTACCCTAAAGTCCACACTCTTCCTGCCTTGACTGAGTCTGAAATCCTGGAGCTCAATGCGCTGCCCAAGCACTTGGACTGGTGTGACCAAG
TTATGTGTACCCCGTCGTGGAATCAGCATATTCCGCACTACTGCGGTTCCTGTTTCGCCCATGGAGCACTGTCAGCAGCCCAAGACCGCATTAAAATGCT
CCACAAGGCCCAGGGCTACCTTGGCCCTGATGTCCAATTGGGACGCCAGACATTCCTCAACTGCGGACCGGCTCACGGTCTCTCTGATGGTTGTGGTGGT
GGGGAACCATCGGATGTATTCGAGTTCATGCACCACTATGGACTCCCAGACGAGACCTGTGTGCCATACAGTGCCACGGACTATAAGAAATACACCGAGA
CCAATGGCACTTGCCCCCCCCGAGGGATACTGCATGAAGTGAGTAGCATTATGAGTTTTAGTTTGCAGCTGTTAACCTGTGAATATGTTTTTGGGTTTTA
GCTGTATTACGACTCCGGATCATCCTCAGGGTCCTCACTGTTTTCCAGTCAAGACCGTGGTGCGTTACCGTGCTAAGGAATACGGTCGCGTGTCGGGAGA
ACATGCTATGATGAAGGAGCTGTTGAACGGACCTATCACTTGTGGCATCGCGTGCAGTGACGAGTTCACGTTTAATTACTCTGCGGGTGTCTTCCATGAC
AAGACCGGGTTTTTGGATATCGACCATGATGTGGAAATTGTTGGATGGGGTGAAGAAGCTGATGGGACCAAGTACTGGAATGTGCGTAATTCGTGGGGAA
CCTACTGGGGTATGAAGGGAGGGTTTTTCAAAATTGTACGCGGAGTGAACAACCTTGGCATCGAGTCGGACTGCCATTGGGTGCAGCCCGATATTTCGGA
CGAGGAGTTGGTGTTTTCTCAGACGACACCTCTGTATGGAGGTTCTCTGTGGGGAATTGTGCCGTTTGCAAAGGATGCTGCGACGACGCACCCCATCAAC
ACGACGGCGGATGTCGTGTTCAGTAATTTGCCTTTGCAGTCCGAAGAGCTGCCTGAGGTGGTGGAGATTGTTGGACACAAGGACGAGAAAACCCCAATGG
AAACTGTGTCATTGCACATGACAACGAAAACTGTCATGAAGGAGGAGCAAGATGGGAGTGCTCAGAACGAAAGTGTTGGATTGTCCGTATTCGCACTCTT
AGCAGCTTTTATTCTCCTGGGTACGGTGATCAGCAACCTAGTGACTCGGTTCTCGCGCGATGAGAGGTACAACCGCTTGATCTAGG