Description :
From Genome Similarity Track
Location :
Scaffold_54:3687- 9083
Sequence
5396 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTAGTCCGTTCAACGACCATGAATATGTTGGACGATGAGGGGGATGGTTTTCATCCCACGCATGAAAGCTACTCCCA
TTTGAGTCAAATCGAATGAGACGCTGTCGAACGCTTGAGTTCAACGATAGGGCAAGAAGCTGTTGGCGCACTGCTGTCCGCACTGGGGCCAGTCGGACAG
CACGCCACCATCGCCAAGTTCATTCAGAATGAACTTGATGCCGAGCGGAAAAGTAACCTTGCTTCACCAACAAGGTCCTCAACAGATAGAGCTGTTGAGA
GAACATAGTGCTCAACAGTTTGAACTGTTGAGATAGCAGAAGGCCACTGCTACCGGGTCGACGTATACACGTTGACCCGAGACTCTAAAGATTGACATCT
CAAAGTACAAGGGAGCCGATGAAGACTCTCTATTGAGATGGTTCGTGGAATTAGATGATGCCATAAGGGCTCGTCATATCGTTGATGAGGAAATGCAGAT
CGCATTTGCTCAATCGAACTTGGCAGGGCGTGCAAAGACGTGGGCCTTGGGCCTTAAGTTATACGAACCATATGTATTTGGGTCGTTGGAAGTCTTCAAG
TCCCTGCTAAGGCAAACTTTCGAGCCGCCGCAAGCTGAGTTCAGGGCTAGCGATGAACTCCTTAGAATCAAGCACGGTAAACGTGACGTACACTCGTACA
ATCAGTACATACGTCACCTTACCAGTTGCATAACAGTCGACCCACTGAACCAACAAACGTTGATTACGTTGTTCATGCAGGGTCTGACTGATGGTCCTGT
TAAAAACTACCTGTTCCGATTGGAGTTCAACACCCTAGAAGAGGCAATAAGGGTTGAGGAACAGGGGGACCTCAGCGTGAAACAGACTCACGCGAATTCG
AATTCCTATCGTCCGTCGAGACGACAGGAACATGGAGGCCCAGAACCAATGGATCTCTGTAGCGCGAGGGGCGAGATCTCTCGTGTTATTAACTATAAGA
AATTGCAAAAATGCAATAGATGTCAGAAGACAGGGCATTATGCATATGAATGCAGTGCCCCGAGCGCGGTACCACGTACCGCAGGAAACAGTAACCGCCA
AGCGGCCAAGCGAGGTCCAAGGCGTGGGTCCGACGTTGTTGCGAAAACTCAACAACGTAACGGACAGCCAAAAAACGGTCAGGGTCAGTAGGAGCGGAGC
ACCCTACTGATCCAGCAACGTCAAGTGAGTTTGCAGGCCTCTTGACGAAAGTTGCTCCCAACACTCAGTCATTGTGTGTTGCTGCTTCTGTTAATGAGGT
TTCCCTCATTACCTTGAAACTAGAAGTAACACAAGGCATGTCGCTTCGAGCCCTAGTCGATTGTGGGGCGTCGAACAACTTTGTACGACGACAATCGCTA
GACAAAAGAGAGCTCGAATATGTCGAGCGAGAGATCCCTCCAACGAGAATGACGGTGCGCCTCGCGACAGGCGCATCCGTAACAGTGATGAAACGTGTAG
TGGGTATCACCTATACACTGGAGGGAGTCCAGTACAATGATGACTTCATCATATTAGACTTGGATGACAAATTTGATGCAATCCTTGACTGCCGTGGCTC
AGAAAGTACGAGCCACAAGTCATCTGGCATCGACGAACAGTCGATATGCCTGTCACTTGTTCATCAGATGGCCATCTGATGAACGCCATGGAGCGCTTAA
AAATATGTGGGTGTAATACGAGCGAGTGCGATGGCCTCACGTGTGGTGCGGTCGTTAGTACGACTGCACATGGCCATGGAGTGGATGATCGCCACACCAT
GAAGTCAGATTCCGGCAAATGCGTTGAGATGCAGGTGGCGCCGAAGGTCCACCACCCGAATAAAATCGAGTGGACTGGGGCATGGGTGTCCTCCAAACGG
ACAACATTCAAGTGAAAATGAACCGATTGCCAATGATTGGCAATACGATGATCTTAGTGCGATTGGAGAATCGCACGTAGAAGACCTGGCGGTGGTAGCG
CAACCACCACCAGAGGATAACGAGGGAGCAATTCCACTCGTGTCAGATGATGAGATAGCCCAAGAGGCTAGTGAGGGAATAAGTCCCCACCCAACTGTGG
AAGTAAGTTCCCAGGAGACAACAGAGACATCAAATGTCCTAGTCAATGACGGATCAAGCATAGAAACATACTAACTTGATCTGATCACGCCTCCGAAGAC
AACCTCGGAGATCATTCAATTGCCCACGCTCGAACAGAAAAGGCTCTTGCGTGATCTGCGTAGTGGCAAAGTCAAGCAGATTTGCGTACTCGTCGCGGAA
GACGAGTACGTAACCGATATTCGGTCGTCAATGTTATTCGCTGAGAACGAAAGGTTATCAGCAGCTCATCAATGAACGAGGGTGTCCTTGATGAGAAGAC
TCGGATATAGCGATATACATCCCAATCGTGGGAATCGCTCAAGACAAATCTTCTCTACGATGATTTGACGGAATTCAGGGATGTGTTCCCAGAAACAGTG
CCGTGCGAGCTACCCAAGGATAAGGGTACTCGCACGGGGATAGACCAGAAACCAGGGTCAAAATACTGTGTCATGAAGCAATGGCCATTGCCTCGTGAAC
AAGTACTAGCGATTGACAAATTATTTGCCGATCGCTTAGCAACGGGCCATGTGAGGGAATCTACTTCCCCACATAGCTTTCCGACCTTCTGTGTCCGAAA
GACCACAGGAGGATGGCGGATAGTACATGCCTGCAACAAGTTGAATGCTGCCACTGTACCGGCTCAAAAGCCGATACCAAGAAAGGATGCCATTATAGAT
GGTATGTCAAGGAGTACCATCTTTTCATCGATGGATCTGATGGACGGGTTCTACCAGATCCTTATGCGTGAAAAGGACATTCCTTATACAGCAGTGAGCA
CCCCAAGCGGTATGCTTTGGGAGTGGCTAGTAATGCCACAAGGGCTGAGTAATGCCCCTGCTACGTTCAACAGATGTGTTACGAATCTGTTGAGATCTGT
GCGAGAATTCGCACCCAGCTATTTCGATGACGTGTTCGTCCATAGCCGGGCTATGGATGGACAGACGGATTTGGAAGTCCACTGACTCCACGTCCGGAAA
GTTCTTACACTGATGCGTGAGCATAAGTTGTATGTAAATCTCAAGAAGTGTATATTTGCTGCAAGCGAAATACCACTTCTTGGATGCATCGTGGGCAAGC
ACGGCGTCCGGCCCGATCCGGAAAAGATCAAGGCGATCACTGACTGGCCGGTGCCTACCGACATAAAAGGACTTCGAAAGTTCCTTGGTCTAGCGGCGTA
TTTGCAAAAATACTCGCACAATTACGCCGAGATGACTGTTCATCTATCTCGTTTATTAAAAAAGAACGAGAAGTGGGCATGGAGTGCTGATTGCCAGCGC
TCTTTCGAAGGTATCAAGCAAAGCTTGATACGCTCGCCAGTTTTGGCTATTGCAGACCAAGACAGACCATTTCATGTGGTCTGAGATGCAAGTGATTTTG
CCATCGGATGTGCACTAATGCAGAATGACACATACGGTGCTGAACGTGTCGTCTGCTATCAGTCACGTCAGCTGCAACCGGTTGAACGTAACCACCCAGT
CCATGAAAAGGAACTCCTTGCCATGAATTATGCTTTGGAGAAGTTCAGGTTCTATCTACTAGGTGATAGACCCTTCATAGTATATACGGAACATGCGTCC
TTACGCACGGCCGTTAACAGTCCACACCTCTCGCAGCGAATGGCGAAGTGGCTATCGTTCTTCGCGGAGTATAACTTCTCCGTGGAATACAAGCCAGGAC
GACTGAATGTCGTCGCTGATGCTCTGTCGCGCCGGCCCGATTTAGAACCGGCTGCACAACCCGACACTGGTCCGACTACTGTCGCGGTGTTGACGTCGAG
TGTCCCGTCGTCAACCTTATTCGAAGACATACGAAAGGCGTTCGATCCGGCGATGGTGCGTTTGATGGATCCTCTCTCGCAACCATCCCGTCAATCCCTT
AAAAGTCTGCCCCCAGTATATCGATCCTCCACGGATAGATATACAGTCCACAATGGCTTACTGAAGTATACAGCCGTTGCCGGTGACACGCCTCGTGTCG
TCGTACCGGACAATGGTGAACTGCGTCTGCGCATCATGTATGAGTACCACGATGCACCTACTGGTGGACATCGTGGTCGAGAGAAGACATATCTCACAGT
TAGTCGCGACTTTTACTGGCCCCGCCAGTATCAGTTCGTGCGAAAGTACGTCCGCGCATGCGAACTATGTCAACGAGTGAAGTCAGGTCCTTCACTTCGT
GCACCGTTGCAAACCTTGCCCATTCCGGCGGAATGCTGGGAATCAGTCTCAATGGACTTTGTCTTTGAATTCCCCGCAGACCCACACAAGAATACAGGTA
TTCTTGTGTTCGTTGATAGGTTCAGTAAAATGGTACACCTGGTCGCTGTACCTGAATCTATCAATGCATAGGCATGTGTTCGTGTTTTATTGACACGATC
TTTTGTCTTCATGGGTTGCCTCGTGAACTCGTCTCTGATCGAGACCCACGATTCACTGCGGAATTGTGGTGATCCGTGTTCAAAACACCCGGAACGCGCC
TTCAGATGTCGACCTCTGACCACCCTGAAGCAGATGGTCAGACAGAACGTGCAAACCGCGTTCTTGAGAAAATCCTTCGGGGTTACGTCCATTCGTTTAC
GAATTGAAGCGAATTCTTGCCAATGGTGTAATTCGCCATCAACAACTCGGTGCATGCATCGACGACGCATACACCGTTCTTCGTGAATGGCATGCGCCAC
CCACGCCTACCAACCTTCTTAGAGTGTATCTCTAGTTTGACGGGGGGAGGGAATCATTCGAGCGAACACCAACTCGGCTCTCACTCATCACGTACTGACC
ACGAGGTCACTACGTATGACGCCGATGTCGATCACATCGACTTCGGTGAAGACGAGGAAAGTAAGAGCGAGGATGCTCTTACCACCCAGGTCACTGATCT
TGCCACAGTGCGCTCCAAGCGCACTACAGCCAAAGACAGCGAGTCAGCAGATGAATTCATACTGGCCCTCGAAACGGTTGTCCGTTTCGTGCAAGATTCC
ATTGCAGAAGCAGTGAACCGACAAAAGAAAAACGCAGACAAGAATGGAAGGGCAAATGTTCTTTCATTTAACGAAGGTGACCTAGTCCTACTATCTACGG
TAAACTTACCTTGACACATATTGACTAACGTGGGTAGTAACAATTTACTTTCCAAGTTCATCGGTCCATTTCGTGTGCTGCGCTGCATAGGCAACGCATA
CACGATTGAACTGCCTCGTAAGATGCGCACGCATCCTACGTTCTACGTCGGTCGCCTTAGACCTTATCACCAGTACGGGACTTCTTCCTGTGAAGA