Description :
From Genome Similarity Track
Location :
Scaffold_51:3687- 6808
Sequence
3121 bases(100 bases per row)
TTTTGAGTTTGATTCATGGGAGGATTTAGAGAGCTACTTGGCCGAGTACACCAATGGGACACACCAGGTACAATAGTGCTATACTTTCTATTCATTAGGC
ATTTCTTACCTGACTGTTGTACTTTGTTGAATTCGTAGAGCTTCCGTATCCGCACGAAGAACACAGTGACTGCACGCAATGCCAAGATTCGCTCAACGGG
GTCAAAGAAGCCGTTGTTGCCGGACGAGTGGGTGAACTACGGCAAGACCTACATATGTACACACTTAGGGACGTACAAGTCGAGGGGGAAGGGGAAGAGG
AAACGTCTGCAGTCGCGGGCTATGGAGTGTGAGGCGCAGGTACGCTTGTACCTCAGCTGGTCTTAGTTGGGTTCTGTTGGGCTCGGTTGGGCAGTAGCAC
CACGAGCTGGGGGTGAGTTGGGTCGAGCTGGGTCGAGTTATGACTAACTGTGTACGTCGTTCTGTAGTTTCTTAATGCAGATCAATGCGTGTGTCCAAGT
TGACGACGCTAAGGTCCCGACATTCATCTTGAGAATCACTTCCGCACGATTAGTGCACAACCACCCTGTGAGCAAGCTGACGTACAACCAGTATCCACAC
GTGTGAACCGCGTTGGCGTCGGATCTTGTGGGTACAGTGAATGAGCTTCGGAAGGCCTGAGCAAAGAAGAAGCGTATTCTGAAGTACATTCACGACAACA
CTGACTGTCGTGCACAGCCCAAAGTACGATAAGGAAATGAGGTTCGTCGCTCAAGTAGTCCGTGAACACGCATGTGAGCTCATTTACGAGCAGTACGAGT
ACGCAATTACGGGAGCCAGGTACAAGTACTACGAGCCGGTGCCCGATATGTTCCTAGTTCAAAACGAAAGTGAAGACGAAAATGCGCTAGATGAGCCTGC
AAGTGAATATTCTGTGGCAAAACGAGACTGGTCATGCTCTTGTCTATTTGCGAGCTCTCGTGTGCTTCTGCAGCGGGGCTGCCGTAGCTTTAGCGTCAGA
GGAAGACGTTTGACTCAAAGAGTCACTAATACTAAGTTCCTTATCCAAAGGAACTTACAGCCCAAGACCAGGGCTCAAAGTTAATACCTTAACTTTTATG
CTTCAAAACCAGAAGTGTTTTATTTACTATTATTGCGGCCAAGCCGCCTAGGGGTAAATGTATCTGTTTAACTATCTAGCATAGTTAAACCTAATCAATT
GCATAACGTGTGGCTTTCGGCCAACGTACTGAGATACCTTGTTAACTCTCCAACTTATGTACTGAGAGTTTGTTAACTCTCCGGGTACTTCGTACCCCTG
TGTGTTCCACACCATGTAACCCCGTTACACTCTCCCCCACTAAGATGAGAACATTCCGTTCTCGAAACTTTCCTCAGCGAGGTCACGTCTTGCTAAGACG
GCGGAGGTTACTACACCTCACCCCAGCGTTGTACAGCTCCGTGAGCTAACAAACGCCTACGCATCGTTGATGCCCAACTTCTCGTCGTCGGCCCACGGCC
CAATGTTTCAAGCGCAGCGCGCATCTTGCTCTCAAGCGGTCTCAGACCTACGCTCGCGCTCCGCGCCTACTCCAAGAGTTGCAACGGCTTAGAGCAATGC
TCTTGACTCGTTCGAGTCGTCGACAACAGCTCAGCGGTTGAACACTCGCTTCACAAGCGATAGGTCGGTGGTTCGAACCCACCAGGGCACAGCCCTGTCG
TTCCATGGCCGATTGTTCACGCTTGGACAAGCTTAAGAGCAATCCGCTTTTAGCTCAGTGGTCGAGCGTTGGCTTTGGAAGCCACAGGTCGGTGGTTCGA
ACCCACCAGGGCACAGCCCTCTCGTTCCATGAACTGTTGTCCTTGAATGGACAAGCTTAAAGGCAACGCCCTTTCAGCTGAGTGGTCGAGCGCTGGCTTT
GGAAGCCACAGGTCGGTGGTTCAAAATCACCCGGGCGCAGCCCTCTCATACCATGAGTAGTCCGTTCTCGGACTGACGTACGGGCATCGCCCTTATCACT
TAGGGCTACGTACCCCGTTACATCCTCCCCCACTTAGGTTCGGTTTACCGACCAATCAGAATGAAGAAGTGTTCGTCACAAACTCTCATTCTCAAAGTCG
AAAACCATCGACTTGGCCGCGCGAGCGCGGCGGAGGCTCACTTCACAGTTAGAGCCTCGAGCAGCAACCTGTGCGCTCTTCGTCAAGGTCTCCACTTCGA
CCGTTAACATGCCTCGCGGCACTGCTAAGAGCGGTGCTAAGACACGCTCCAAGGCTGCAGCCGGTAAGGCGCAGGCCAAGAGCACTAAGCCTCATGGCAA
AGGTTCTGCACTCAAGGAGGCTACTCAGGTGGCCTCCGAGGCGATCGGTTCCTCGGGTGACGCGGCTGCGGACAAGCGCGCAAGCAGGCGCCGCAGTCCG
TCGCCCTCGTCTTCAGACAACCGTCCGAACCCTCGGTTCGTAGAACGCGAGTTCAACTCGGGCAGTGAAGACGATGCCGAGTCCGAGAGCACTCAGGATG
CTCCTGCGGGCTCTGTGGGAGGGCACAGCCCAGTGCCCAGTGAGCACAAAGAAGGCAGCGTGCAGTCGCCCGCTAGTGATCACGGTGATCACAGTCCCAG
GACCTCTGTGCGCTCTGAGAGCCCGGCCGTCAAGGCTAAGGCGCTCCCAAAGCCCGTGGCGATGAGGAAGAGAATCCTCGCAAACGTCTCTCGCTTACCG
AGGGTCTTGCGCGCGCTAAGGCCTCTAAAGCCGAAGGCGCCAAGCCCTCAAAGAAGCGTACCGCCTCTAAGTCTCCACTCCGCGAGGAGAAGGAGACTCG
ACGCTCCTATCAGAGTCTCTTCGGCTCCTTTTAATGAGGAGGAGGAGAAGGAGGAAGAAGAGGAAGAGGAAGGTGCCATTGTTGAGCCCCGGGAGGTCTC
GAATGACCTCGACCAGCAGCAGGAGGATTTCCAAGCTGCCCAGCGTGTGCGTGGGGGTTCGGTGGCGGCACCCGTCAGCCAGGGAACTGCCATCAACTCA
AGAAGGTATTGGCCTCCCGAGGAGAGCTCTGGGGCCGACCTCTTCTTAGAGCTTCTCGTCGCTCCTCGTGGCCTTGTGGGCGGCCACATTTCTAGGGGCA
TCTATGAACGAGCCCTTGTTC