Description :
From Genome Similarity Track
Location :
Scaffold_252:36868- 38905
Transcript NameFunction/comments
Hyaar_Emoy2813199hypothetical protein

Sequence
2037 bases(100 bases per row)
CTCACATCACCGAAACTCTGGTCCGTAAACTACGAAACAATCACCACTTCTAGTGCTGCAGGTTTTTGCCCAACAGCTAGTCTAGGAGGCACACAGGGGC
GCCAAGCAAAAGAGAAAGCATGCATATATTTTCGATTATTACACTTCTCAAATTGACTTTGAAGCGCACGGATTCATTACAGGAGGACCCATATACCGCA
GCTTTACGGTACTCAAAAACTTGCCTTGTACTTATGTACGGAACAACCATATGGTCTGTTGCAAACCACTAGAAGTGAAACCTAGCATTATGAAAGGCAG
ACATTCATTTTATGGTGGTGGAGTTTTCGCATTTTTTGGCAAGGAGTGAAGTATAAAAACCAGACTTTTTAAGTTATATTTGTGGACCGCTTGCTTGCGA
CGCCAGTTCTATCGAGGATATGCGGTTCATTTTAGCTGTCGCATGGTCTGAGTGTACAATTTTGGGCACTACCAACCCCAACTTTGATCAGCACTACACG
GGTCATGCACGGGGTCATGCGCAAGGTTATCCATACAACCCCTAGCTTGTCGTTTGGTCCTTGCATACGTAATTGCTGCTCATTTCCACCGCGCGCAGTG
CTCAAATTACATACATTGTAACGGGGCAACAATCGCTTGTACTGTCACAGTACAAGATTCTTACACCGAACAAAGAGTAATTAGGTGCCTCGAAACTTCA
CGTACACATGTCGTACAGAGGAAGGTTTAGATACGAGATAAGGGTAAAAGTAGAAGTGTATTTTGTATACTTAATCTTCTGTTAATAAATCCTATTTAGT
CATCTTTTAACTAAACCTAAATACAAATATAACGATCTGCTCACCACTCATCGCGTTCTTCTGTCGTGGATCGGCTTTATTGGCTGATATCATTGACATA
ATAAACATATTATGACTTCTGCATTACAATATTATTTCATAAGCTAATATTGTGAGAATATGATGTCTAACATAATATTCACACTTGATATTTACCTTAC
GTAAAGTATCCTATAACGGAGGCACCCCATTACATCACTTCCCCTATAACATCAGTCAGATTAGTGACTGATTGATGACTGAGTAAATTTAGGACAGGGA
AGCACTTGTTGTTTTATTTTAACCATTCCCTCTTCTCATCGCAAGGTTAAGAAGTCCATGCGGTGCGCGGCCAAGGCTGCCGGGAGTGCAGCAATGAGAT
TACGTTCTCCAGACGCGGAAGAGGCAAAGACTTTAAATAAAGCAGGCGACAATTCGCCTGCTGCTTCCACTACTCAGCCTGAAGCAGTCGTTTTTTGTAG
GCTCACGCGGTGATCCACCGCGTGATATAAGCTCGAGATCATACACTTCGGCGAGTTGGATAGCGACACCGACTCGAAGAAAACAGTCGGGAAGACATAG
CCAGACATGGCCATGCCTTAGTCGACCAAGTCGGACTCTCGAAGCGCTAGGATCCTCCTTGAGCGTCGTGGCATCTTCGGATAGTCCGAAGAGTCGGACG
ATCCGTCTCCGAGACGGAGTCGTTTGCTCAATAGTGATCGAGGCGGTGGCTTGGTCCATTTTAATGACGGTGATGCAAAGATGCATCACGATCAAGAAGA
TCGTACTGGTCGTGGTTTCAGTACTTCTATTAATACCATGCAAGAAGCCAGACATCGCGGCATCTTGCGCGTCTCTCCCGAGAAAAAGGCGTGGCTGCCT
TCTGATCGAGTGTTGGATTGCTTGTCCGACACTGTGAACGGTCGTTATAGGATAAGAATATTCGATTCATCAATACTTCATAAACTTGACTCCAGTGCGA
GTGACTTTCGCACTGAGCATGATTTCTTCGTCACTGTTGTCTTTAAACATCGATGGTATAGCAAGAACCATAAACGTGATGGTGAGTCGCTGACCCAGGC
ATAAAACGCGTTTATCCACAATTTTGGGGAGATTGGACGCGATGCCTGGCTTGACAAGCTGACCTTATTGCGCAATAGGTATGAAACGCGGACTTCGACC
GGTGAACGTTACCACCTGTATCGCTTATCGAGAGAGG