Description :
From Genome Similarity Track
Location :
Scaffold_39:368641- 369855
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14317inorganic pyrophosphatase
Phypa_INRA-310PPTG_14318hypothetical protein

Sequence
1214 bases(100 bases per row)
GTGCGGATGAAGCGAACGGCGCGGATCGGGACGTGGACCATTGCTACCGCACGTCAACTGCTAAAATGAATCACGAAAACTTATACCCTGACCTGTGGAA
CAGCATACCATTTAGTGAATCAATGAAACCTGATGCTTGACATTTTCAATCCCTACCTAACGCAATTTGGCTTAAGCAAGCAAATTAAACGTGTTAATAT
AAAACATACAAAAATGTCTTTATAATGTGATAAAGCTTATTATTGTTCAGCTTTAAGTTTTTTTAAACCATTCCGCACTGTCCGCGCTGATGGCGACGCT
GCTAGACACGACGATGGAGGCGCTGGAGCCGGAGGAGCACGCGGACAACAACCTGCGTGTACCGCAGAGTGCGGAGCCCGAGACTGACGCGCCCGAGGAC
GAGGACGACGATGAAGACTTCCACTTTAACGCTCCGTCCTACTACGACCTGAAGAATCCGGCGCTGGAGCGGCGCTACGTCAACAACGCGGACGGCTACT
TCTCGTCGCCCGCGCCACCAGCCGCTATGTTCAAGCGCTCTCCTTCCACTATCGATAAGAACGACGTATCAACAGAGCCGCCAGTTCCTGTAACAAGAAC
GTTAAGTAAAAGTTACGAAGATTCAGATAATAATAATAACGCGCTGGAGGAAGATAATGATGAGGAGATGGAGGAGAAGGCCATGCTGGACACAACCATG
GCTGGACCAGAAGAGGAAGACGTGGAGACGGTGCTGAACAGGAGCAACTTGCTGGACGACAGGGAGGAGAGCTTCGAGGAAGTTTTCAGACACTACGCGT
CGTCATCTCAGTCTTCCGCCACGTCCTCGTATCTACTCCATGAGCTGGACACTTCTACACACAGTTCCACTCATGGAGGTCACTTTTCTCCTCACAGTTC
ACAGACATCTTCGTCATCTGCGGCGTTAAAGGACAATACGAAGAGCAGGGCCCGGGATCCAGTCGTCTCGTCCAAGCTGATGCAGCCCACGCAGTCGTAC
CTAAGACGACTGCAGGCGGAGCAGAGGATGAGGGAGCAGAGCTACATGGAGGACATTCCCGTGGAGGAAAAGCCCCACCGTGTGACTCGGCCAAGAAGTC
CAAAGCTACACACCAAGACGCGACCAACGAACCCGAACGATGTGTCTCGGATGAGCAGCACGAGTCGAGAGCTGCTGAAAATTCAGGAAGAGCGACTGCA
TTTGCAGCTAGAGA