Description :
From Genome Similarity Track
Location :
Scaffold_97:36863- 44030
Transcript NameFunction/comments
Phyke_g4231hypothetical protein PHYSODRAFT_508787
Phyke_g4232hypothetical protein
Phyke_g4233conserved hypothetical protein

Sequence
7167 bases(100 bases per row)
AGAAGCAAGAAAGCGAAAGTCGAGGATGTGCGGACCAGACGACATGGGCGGTCCTGGTATGGACATGTGCTGTGAGGACGAGTGCTGCGGGTGTTTGGCC
GGTCTGTGTTGTGCCTCATGTTGCATTGCAGGTGCATCTGCAACAGACAATGGAGATCGCCGAGGTCGACGAGGATACAACTCGCCACGGGAGGTATACG
TCCAATCAGTGGTGGTGCAACAGGGCTACGAGTACCCACCGCCACCCCCACCAGGTTATGGGCCGCTACCACCCAATCGTGCCTATTACTACTAAGTTTT
CCTCCTTTAACATGAGCAATGAACGCTCGAATGCATTCGCGAGACCCAAACACTAGCGCGGAGTCAGTGCTGACTTGACAGATAACAGCTAACGGAAATG
TGTCTATAGCGTATCGCTCGTCGTGATTGATGATAAGATAACGATAAATAAATTGTTCTTTGCTTTTACAATGCACACTTGCGATGAGCAAGTTCATGCT
AAAGGCGTAGACGAAAATGAGTCTAAACCTGCGGCGCCCGGCACATCCTCAGATTTTCTGAGTCGAAGGTGACGAGAATCAGTAAAATGGGAGGCGAGAC
GGTCGTGGGCACGAGACTGCATTGGCACAGCCACTCACAGCGTGAGCGCATTGATGTGGAGAAGTTGCTTCGCCAAGTGAGCGCATTCTGCACTCGTGCA
GCTTTGTGCACCAATAGCGGCATTTTGATTGCCGTGGGGCTGCCTACTGGAGCTGTCGGAGCAATGAGCGGAGTTTGGTCGTCCTCAGATGAAGACTCTT
CCTCatccagcgtcttcatccagtcAGTACGGGAGTTCATGATACAATTGCAGACTGGGGTGGCTGCAGGGTCTATTGCCGGCAAGGTGGAGATCATTCC
GATGGTGTATTGGGGGAAGTTCGTGCCGGCACTGAATGCTTTGGTGAGCGTGGCAGCCGACCGCTTCCCTGAAGCAGacacgttgctgctgcaatctctt
gaggttgaagtggataAGGTAGGGGTGGAATTCCTGCGTTCGCACTTTGACATCAAGCGTGATCTTGTCGTGGGGGCAGCACTTTCAGGCCACGAATTTC
AGCCAGATCCGAGCGTGCAACCATTGAAGCTGAGCGGGCTGACATCGCCATGGAACACACTTGCACTCTGGAATCTGGAGCAGCTAACGAAAATTGGATT
TGCACTCATGGGAGACGCTTTGCGGCTTGAAGTTGACGGGATCGGCTCCGCAGCGGGTATCGAAGAGGTCGCTACCATTGCAATGTACCAACAACTTTAC
GCGAATACCACTTCAGCAACCAAAGCAAAGTTAATGCGAGTGCCTGGTATCGCGTGGCAATTGGACGGGCTACAAGATCCTGAACGTCTCGCGTGGCACG
AGAAGAAAATGACGAGCAAACAACAGCGTGCAGCCGCCCAGCTTACGCACTTTGGTGGAGTGGCTCCTGGTAGTGTCTATCACCTAGAACTGGAGGCATG
AACAATAGTGACGTAAGATCGATGAAACCTCAACGACACTTAGTACACTGCTAATAATCGCAAGACAGCGTGTATCAACTGCAATAtgagcagcactgca
acaGCACGCTTGTCTTCCTTAGAACTGGGTCAAAGCTGCCGTTTCTGTGACATCGAAACCGCGCCGAACTCGGCATTCTGCAGCGAAAATGAATGGCACG
ATGGTTGTTGGCATGATGGTCGTTGGCACGCGACGTGGAAAAACTGTTGCATCGATTGCGCGAGTTTTGTGCCCGTACTGCAACGTACGCCGATGGGTAT
CCTCATCGCCGTGGGTCTTCCAACTGCGATTGGTGTCAGTATCACAGGAGCATCTTCTACATCCGTCTCAAATGACACAATGTCGatctctccatcttct
tcaaagGCCACCAGTGTCTTCGTCGACTCAGTACGTGAGTTCATGAGGCAACTCCAGAACGGAGTGATGAACGGCACGATTGCCGGCAAGGTGGAGATCA
TTCCGATGGTGTATTGGGGCAAGTCTGTGCCGGCACTGAATGCGTTGGTAGAGACAGCGGCAGATCACTTTCTAGTCTGCTGTTTCAATCTCTTGAGATT
GAAGTGGCGTGGCGTTGATACGCTCGAACTTCGACCTCGAACACGATATTGTCGTTGGAGCGGCATTGCCCAGCCATGCCTTCCAGTCCGACCTGAGTGT
GGAGCCATTGGATTTGAGATAATTGACTTCGCCGTGGAATACCTTGGAGCTCTGAAACTTGGAACAATTAACCAAGACCGGGTTCGCTATGATGGGAGAC
GCATTACGTCAGGAAGTCGAAGGTGCCGTCCCCGCCGGTGGGGACGAGGGGTCTCGACCATCTCAATGtaccagcagctcttcgttAATACTTCATCACC
CACAAGGGTGAAACTCGTGCAAGTAACATGTGTTGTGTGGCAGGCCGTTGAGTTTAAAGACCTGAAGCGTGTGGCACGGCACACCATGAAGATGCGAAGC
AAGAAACTGCGCCTGCCGCCCAAATGACTCACTTTCAGTGGCGTGAGACCTGGCCAAGCGTACCATATAGAACCGAACCTTCAGAATGGAGCCCATCAGA
GCAATGTAGTTTAAGCACTGTAGGTTCGAAACAACGTGTACATGTGCAGCGAATGGCATTGACATCCTTTCGATTGTACGACAAGGGGGTACAATTTCAC
AAATTACGGTACAGGTTATGGTCTTGAAGGACGCAACCCAAACAGACGACGTTTGCGACGAATGACTGAGGGCGATGGCATCCAAGCGCGCGCAGCCTCT
CTGCGTCAGGACGCTACACGGCGGTGGCTCGTAAAGGACGAACTggtgtttctgctgctgtactaCAAACTGGTGGACGTTCCAGTGCTtcactcgctgc
agctgcggcCTCCCAGTGCGTTTCTCTAGTGGCTCCTGTCGCTTATTTGTTGACTTAATATTGGACTAACGCCTTTGATTGAATGGTTAGGCGGAACTTT
ACTGTTCTACAATACCCTGAAGGTCCCAGACTATAAGAAGGACGGATGGCATTggcagaagcgcaaggacaAGAGCGGACGCGTAAGAGAGTGCAGTTTG
TTTATGTGAGTGGGACTATAGGCTCTAAACTATTGATTCTTTGCTGTAGGTCCGTGAGGACCGAGCAAAGCTGGTGATCAACCGACAAGTGATTATTCTG
GGGAGCTACGTGCACTCTGCAGAGACTTCTGTGCGTGAATTTAGCAGTTCTTTAAGTGATTATAGTGCTGTTTTATCGATGACATTGATTTATGTGTTTT
ATTTTGTTATGCAGACATTTCATCGGAGGATTTATTCAGTGCGAGATTCCCAGGAGAGTGTTGTACTTGTGCACTACTTTGACGAAGTCAACAAGGAAAT
GGCGGGTACTTCCCGGTGTTCAAATGCTAGTTttagcaacagcagtcaTAGCACGACTAAGGGAGTGAAGCACTCGTTACCTGCTGTTAAACCAAGCAAC
ATTTCGGCGGTCTCCACGCTGCCCAGTCCTCTCAAACCATCAGCGTCAGAAGAAACAGTTGAAGCCATCATGAAGGGTATGTATGAAACGTGTGCGCCGC
CATTTATCCGTTCTATTATGGACTGACCTAACGTGGAATGGGTGGTGTAATTTTATCGGTTTAGACTGCTTCGAGATGGACTTTGAACCGCATTCGACAT
CGCTCCCAAATCCTGCGGCTAGTGTCTCCGATGTGGACCTACTGCTTTTAAAGGACAATGCCATGGACGGAATTACTACTGTATTTGGTGACGACGATCT
GTTTAATGACCTTACTTCTGCGGCATCGCCCGACAAGAAAGTTAGCGGCGTTGGAGGCCAACAGACCTTTGAATTGGCAGTGATCTCCGATTTCTCTCCG
GATTGGGACTTTGGCGACGGTGGAGCGAAAATCTTGATCTGTCTGGCGGCAAAACTTCCAGAGGAGTTGGCTCAAGATCCAGTGAAACTATTTGTTCAAT
TTGGATCTAAGCGAATTCGTGCGGAGAAAGTGTCCGATACCGTACTTCGTTGCACAGGTATGTAGTTCTTGTGTCTTTTCTAGACTATCGTCGAAAAAAC
TCATGTGTGCTTTGTTTATTGTAGCACCCAGCTCCAGAGAGCTTGGCAATGTCGATTTCTATGTGTGCCACTGGAGCGGATtattgcagcaggaaagCAT
TCAGCTGTCGCACAAGAAACAGTTTACATATCGCAGCCACTACCAAATCTCTCCTTCACTCGTGGGCGAAATTGTGAAGGGGAAGCATATCCCCAAAGTT
GAAGCGATAGATCCTCTCGACCTTACATCACCGTCTTGTTTGCATGGTACAGTTGGCACTGGCAAGCGTGGTCGCTCGCCAACTGTATTCTCTCATGCTG
ATAGAGACAGGAAACAAGCCGCTGACAGATTGAGCGGGTTGAACAGGAATTTGTCTTCATACGTCGAATCGGATTGTAAGTGGTTGGAACTATTCTATGC
TTACGTGCACCCGACATCCTAACCATTTGCCACGTTTACATGATGCGTAGTGGATGAGCGGCAATGCAAGATTCGAGTAGTAGAACGACTGTCGGAATTC
CACCAGGCAATTCGAACAAAAACAACGGAACCAACGGCCCAAGGTGCATTTACATTTGACCCTGACAATAACGGCGAGGGGAATGTGTCTTCAGAGGCAC
CTGCAAGGCCGTCTTTAACAGCCGCGGTGCCAAGATCAAACTCATCGACAACCCAAATTCAACACTCGAAGCAAGATTCATCACAGTCAGGCGGGTCTGT
GGAAACATCGAGCACATTGATTTCCTCCAGCGAGAGATCGATCGCGCTGGATGACTGCACTATCGAGTCACTGAGCGACAACGACCTGGAGCAGCTGTCT
GAGAAGCTACTTGAGCGTGTTGTGCGTCAGCTTGTCACGATTGCACACACTAGTGAAGACCTTCTTGAGGAACTCAACTCGCTCGACGAGACTGGTTTGA
GTCTGCTCCACTATGTGAGCTTTTATAATTATTCAAAGTTGGTGCCAGTGTTGGTTGCTCATGGTGCGCACATCAATCAGCAAAGCACTCAAGGGCAGAC
AGCGCTTCATCTAGCAGCAGGGTGTGGACATGAAGAGGTGGTCGatgtgctgttgcagtcCGGGGCGGATTTGCAAGTTCGCGACTTTGACGGGCTTACG
CCTGCGGATCGTGCGGAGAAGTCTGGCCACACAGGCGTTGCTGCAAAACTACGCCACCACGTTGTAAGTAAGTATGCTATGGATTTGAGTGCAGTCGACG
AAGTCTATGGGTTCGGTGGATCCCCGATGGAGATTGACGATACTCCGACTCCATACACGGATGCTGGTAACATGGGCCTACTTGAAGGAAGTGAACTTAA
TGCAGCCCCACCGCGCTCGCACTCAAGCAGCTGTGAGAGCCCTTGCGAAGCAAGTTGTTCATCAAAGTCGACATCATATGTACGTTATCAATATGTTGTG
TGCATATGTATGAATTATACACTTTATAACGCTATGTTCGCAGGTTGGAGAGAATCAAGAACACAATCGGAAACTCCTGCTCGGCGCTTTTTCAACAATG
AGCTTACACGACAAATGTGCGCTCTCATTAAGTATATCAAGGGATTCAGGAGGCCACGCAGCTCGACGTCGCGAAAGCAATGTCAGCGAGGAAATGAATG
TTAACTCTCCAAGCGGCAGCAGTGTTACTACATCTGTGGGTTTGGGTTCTTCTCCGGTTAGCATGGTTGGCATGGATACCAATCTTATCGGTGGTCGTTT
GCTGCTATCCGGTGGAGAGAACGACTCGGATGTCCAGAGTGTTAtcgctgaagatgaggaggGTTTGACAAAGCTTCAAGCAGCCATGGAGCTCATGGGT
CCTGAGGAGCGGCAGTCATTAGAAGACGAGGTGACGGTCTTGCAGCACGGCATTCGTGCATGGCTGCTTAAGCGAAACTGCAAGAGCATGCGCGAAACGA
CCAAGCAGCTGCGCGAAGCTACACAGAGTATCAAGGAtcagcaaaaacaacaagagGCTGCAGAGCGTCATGCCATGATGGCTAATGAATTGTCAGAACG
CGAGCGTGCAGCAGTGACTGTCCAGGCGGCAACGCGCAGTATGTTGGCTCGACGCACCTTCCTGCAGACGAAGCACGTCGCCATCAAGTTCCAAGCGGCT
ACACGCGGTGTGCTTTGCCGCAAAAACTTCGCACGCATGAAGGCACATGCACTGGCTTCGCTCGTGATTCAACGCAACGTTCGCGAGTGGTGGAACAAGC
AGCCAGCCGCCACACGTCCTGGAGGTATCAATGAAGAACCATACGACCAAGATAAAGAAGATaaaaaagcagaagacaAAGAGTCCATGCCGCCAGAAAC
ACTTGAAGACAGgttacatgaagagctccaccTTTTGTAGAACATATAGGCTCCACCCGCCCCACAGTATAGCAAAGCTCGAAACCAACTTCTGACGTGA
AGCACCGCTCTATTTGCCGCTTCTTCTGCACACTGTTGTCCTGTTTGCTTCATTTACTGAGCTTGGTATTGTCCTTACTACTGTGCATCAGCTTCCTCGT
CCGTGTATCGTCGGAAGCCCGGAATGGGAGGCGTCCAAGTGGCCATGGTGAGTCCGTCAGGGACGGGTGCTTCGTCAATCTCCATTGCCTCAGCCTGTAG
CTCAGCGGGCAGGGCGTTGATGGCCTCCCACTTGAGGTCGATCTTGGTCTGCAAGTCCCgcatgaggtggttgtgctCGATGGACGTCATGCGGTTGAAG
ACCCGGCCGATCTCCTGATgacgctgcttctcctcctctgtCCACTCCTCCCTATATACATAATAAAATTAAAAATTCATTGGAAAAAAACAAATTTGCC
CTTGTTGATAAGACACGTACGCGTCCGGGTATTGGCCCTTGATGGCACGCAGCATCTGCTCGAAGTTGCCATCGTCTCcgcccttcttgcccttcttctt
ggtcttcttggtggcGAAACCACGCACGCCCATGGAGATAACAGATTCCGCCAACACACAGGCGCCAGCACGCGAGGCGGCCGCAGCAGTCACActacgc
agcagcagagccatGGTCTCTCTCGGTCTGTAGCAACTTTTGAgctcttcaccaccacaagtGCCCA