Description :
From Genome Similarity Track
Location :
Scaffold_24:3686- 11636
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_24-snap-gene-0.29Di-N-acetylchitobiase
Pytul_var.sporangiiferummaker-pug3_contig_24-snap-gene-0.30Conserved gene of unknown function
Pytul_var.sporangiiferumsnap_masked-pug3_contig_24-abinit-gene-0.71Rho GTPase-activating protein gacA
Pytul_var.sporangiiferumsnap_masked-pug3_contig_24-abinit-gene-0.79HIRA protein

Sequence
7950 bases(100 bases per row)
GTTACTGCTGACGCCGTTCGGACGCTCGCGCGCGCGCGTATACGCGCCGCAAGNNNNNNNNNNNNNNNNNNNNNNTCCCTATCCACACGCTCAGCACGTT
TGAGCGCAACGTGCTGCTCGAGTGTCCGTGCCGCGTGCAGCAAACGCAGCGTGACGACGCTGACCATACCGCGTCCAAGGACATTTCGCTCTGTCTGCCA
GTGGTTGCGAATGCTGTGCAGCAGTCTATAGCTACACAGCAGCAGCAGAAAAAGAAGAAAGAGGTGTTCGCGTTCTCCGTGACATCGACGGATCAGTGGA
AGAGCTACGACTGGGAGCAGGTGCGAGTACTATAGTAGATCTGATGTCTTTCTTTTTCGTCTTCGTAACAAGTACTGACAGGGTGTGTGTTCATGCGTAG
CTCACGACAGTGGCGTGGAACGAAGACAAGGAGCTGCTCTGTCATGCGCACAGCAAGGGCGTGAAAGTTGTGATCAAGCACAATTTTGACGACGTCGACA
AGCTATGTGACCCGAACGTCAGAGCGCAGTGGATCCAGGTACGTCCTGTATACGCATCATTTGCTGTTCAGAATGCTAAGTAGCTGTTCTTGCTCGTTGC
GTGTGCATAGGAAACGTACACGCGTATTGTGACGAATTTTGCCGATGGTGTTAATATCGATACTGAGAAGGCGATGCATGGGGAGACCGCCAAGTGCATG
ACGGCACTGGTGAAGGAGCTACGGCAAGAGCTGCAGCAGCATGCATTCACCCAGCAAGCTCAGGTTTTTTGTCATATTGCTTATGACCTGATTACTCGCC
ATGTCTAAGCTTCGTGCTGCGATCTATGGATGCCTATAGATTACTTTTGACGTATCTTGGGCGCCACGTGGGGTTGATGGCCGATACTATCAATGGAAGG
AGCTCACAGACGTGGTGGACTTCCTCTTTGTGATGTCGGTGCGTACAGGTGCAAGGACGTGTCAAGGTGGCATCTCCTATTCTCACTCATGTGCTATACA
GTATGACATGCGCAGTCAGATCTATTATCAGTGCATCGCGGCCGCGAATTCGCCCCTGGCGCTGGTGAAGCAAGGACTTCAGGAGTTCATTCTCGGATAT
GGGATCGACCCAAAGAAGCTCGTGCTCGGCGTCCCCTGGTATGGCTACAAGTACACTTGTGAGCAGTACAGTGAGGTCGCTTCCGTCTGCGGGCTGCGTC
CAGTACGTACTTCTCAATCAATTGCTTGTGTTGTTATTAGAAGTGGGCTCTAACGAGTTTCTGGGATCATTCTAGGTCCCATTCTTTGGCGCTCCTTGTA
GTGACGCTGCTGGTGAGCAGATGGATTTCGGTGCGATCATGAAGGTTGTAGATGAGCGGCAGCTAGCAGTGCAGTGGGATGCCATGTCGCAGACACCTTT
TGTCGAGGTGCCTGGATCCGCAGCAACTCCTGGGAACAGCTCTAGTCGTGGAAATACAGGAGCGGTCCAGCAAATTTGGTTCGACGACCCGAGGAGCCTG
AGGTTGAAGTACGAGCTTGTGAGGGAGCTGGGGCTGCTTGGCGCGGGCATGTGGAACGCCGACACGCTGGACTATAGTGGGCCGCGTGCGCACGAAACGC
GTACCATGTGGGCGGCACTGGCCAGTATCAACGAATGAATAAAAAGAATGGCGCCGCCAGCAGGATGACGCACACATGTGGGTTCCTGGAAAAAGTTTTG
CGAGAAACGTTGTGCTTTTGAGTTTGGGTTTTTGTGGCGATCAGTTTCAGGAAAATATGAAAAAAAAATCACAGAAAGATTTCGTAGAAATATAACCGTC
ATTATATAAAGTGTTTAAAACATTATATAACTGTTTTGTTTTGATGTCTTTTTCTATGGATCCTTTTCTCTCTCTATCTATGAGAGATAATGTATCCATT
CGGCGTGTTTGGGGTTCATTTGATACAATACACTCACGCGTATATTTCGAAAAGCAAGTTGGGAGATCTACTACATCTGCTAAGAAACAAACACCAATGC
GAAAGCAAAAAAGGTGAAACCACCGGCTGCATTTGGTGGATCTCAAAAAGCCACAAAAAAGAAAAAAAGAAGAACCTTCGGCGCCCAGGCTGCTGCTGCT
GTTGGTCGCAAAAAGAGTACACGCTGCTACTACCGTCTCGGTTCGGTGTTGTTCCCGGAATGCGTGGCTTTGGTATCTATCTCGTTCTGGGGGCTGGGGC
TCACGTGCCTCTTGGGGGAAACGGAGGCNNNNNNNNNNNNNNNNNNNNNNNCACAACTCATTCCAACGGCCAACGAGCAAGCCCACCGCCGAAAGCTTCT
TTCTTTTCCTCGCCCTGCACCCTCCCACCTCGAATATCCGAGATCGGATCCTCCAAAGCGAATCCAGAATCCAACGGACAACAGCAGATCCTTCCCTTAC
CAACCACGATAGCAATACAGCAGCAGCAGCACGAAGCCTAAGATGGTCCCCACGACGCCGCCGACATGTCCTTCGTCGCCAATGCAGGTGAACCATTCCT
CGATGCAGCAGCCTTCGTCGCCTCATGCATCCGAGGCTTCTCCAGTCACGTCCGCGAACAATACCCCAGTGCCCAGTGGCAGTCATGCTATTNNNNNNNN
NNNNNNNNNNNNNNCGACGGGACAAGACGTCCCTTTCGAGTTCCACTTTGACTTCCAGTCGCCCGTAGCACACCAGCGCCCCCACCATGCGCCATTCATG
CTTGCAACGCCTTCGTCCAAGAAGCACTCATCGCTCGCTCTCCCAATAAGCTGCACTTTTGAGGCGCTGAGTCATCATTTTCACTTGCCTCTGAAGGTTG
CCGCGGAGAAATTTGGAGTGCGTGCGACTGCGTTCAAGAAACGATGCCGCGCGATTGGCATTCGCCACTGGCCATATNNNNNNNNNNAAGTGCGAAGCGT
GAAGCGGTCACTATTGGAGCTTGCCAAGTTCAAGGAGGAAGGAGCTCTGAGTGACAAGCAGAACATTCAGCTTGCGGGATTTGAGAAGGAGCTGGACCGA
TTGCTTTCGNNNNNNNNNNNNNNNNNNNNNNNGAGACGTACGGCATTGACCCTGCGAGCGGCCGCCTTTTTGCGCGCTTCGATGATGACGACGATTGCGA
CTCTGAGGACGACGATGACTGCGACTCTTGCGGCTCACAGAGCTCGTCCCGTGTCGGTAGTCCATACTCGAAAAGTCCCACCAAGTCCAAGTACAAACCT
CGAGCGAGATCTGCTCCACGAGTAAAGAGCACGATGGCATCGAATCAGGCTCAGTTCTTCTACAACATGGTGGGTCACGAACAAATGAACCCGTCGTCGA
TGAGTGAGACTGCGACGATGCCAAGTGTCTCGATTCGGTTTGCCTCGCACCCAAGCTTGAACCACGCCAGCTCGGGCATTCCATTCGAGGCCTACGATCC
GTTCTTTGGTGACTTCAAGAGCGAGTACACTCTGACAATGGAAGACTTTGGGGATGAGGACCATCCCTCATGTGGATACACCCTCGAAGGTGTGCCAAGC
CACGAAGACGATTTCTTCCCTCTTCTCCGTTCTCCAACCATGGCTGCGAGACGGTCACAGCTATCGACTACTGCAAGCACGAACATTGAAGGATCTCGAG
CGCAAAACGAGAGTGAAAACCTGGAAGATGATGTCTTTCTCCACATCTCTCCAGACTTTGGCTGTCTCGTCTAAAGTCTCTCTGCCTGCGTACGGTCCTT
TTTCCTCTCTCTGCATATCATTCACAGCTCATCTGTATCACTATCTTCATTTTTTGTGTGGACATGCATGCTTTGCTCGATAAATTATTAATGCCATTGT
AGTATACGACAACAATGTTGATCGAGTTATCTTGCGTCGTTTTCGGCTTCGTCTTGATGACCGAGCGCCAATCGAGCGCTGAGCAATGCAAACGTGTAAT
CGGCCACTTTCTGGGACATCGTGAGCGCGTACATCGGGTTGTCGCTCTCGATGCTGAACAAGTTGGGCGACATCACGATTGCTATCAGACACACGACGCA
ACATACCATTTCGTTCATAAAGCAATGTTCCTGATCGAACACAGAAAAGCAGTGATGAAAGAACAGCACTTACCCATGCACTTGGCCGACATTTTGTTCT
TCTCCTTGTGCTGGACAACTTCGACCATCAAGTCGAGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGTAGAGGGCAGGAAAGTCGTTGA
GTGTCTCCATAATCTCCTTCGGGTCCTGCGCATAGAGAGACCAATTTATTATGAGTTAACAATGTTACGCATGAAAAAAATAACACGAGTTAGTGTACCT
GTAACTTGCATGTGAGGTAAATGTGCTTCTCCGGGATGACGTTGAATAAGCTCTGCGGTATTTCGCGGAACCAGACCTGTGAAAGGGCAGTTCATCATTT
TCGGCACTTTTACCCAGAACACAATCGGGCATGCTGTTCATACCTTGATTAGATTGGCGATAATGTGAACATCACTGCACCCACTGAAGGTCCCATTGTT
GATGGCTTCTTTCACAGCTGCACACTGATCTTTGTCTGGTGACAGTCGAAAAATACCCTCCGAAGAAATCCCGTTGTTGGCTAATAGATACTCTTTCATC
ATCTGGAGAACAGCAGGAATCTTCACATCGTAGCCATCGACTTTTCGTTTCGGAACGGCTTCTAGCGGTAATCCAAACTGGTGGTTGAGAGTTCGCCATG
CGGCAGGGAGTCCTTCATACCTGGCTTGTTTGGCGTTGTAGGTCACATGAATCTCTTGCCGCGTCTTGAAAGGTAAACTGATCTTATCAAGTGATGAAAC
TGCGCCACTCGCTTCAATGTCGCCGTCCAGCTTGCTTGTCTTGACTTCAATCGATGTCCCGCACTCGTCGTCAGTAGAATCGCCGTTAGAGTTACTGTCA
CTGCCATGTTCTCCATGCGGAGAGGCTTGGTGCTGACCAATATTGTCATCGTATGGATCAACTTTCTCAGCCTCCTCTTGGTCGCTAAAGTCTAGAAAAA
TAAAGTCAATCTAAAGCATACTATTAAGATGCCTAGCGCAAACAAACTCACCATTTGGTTCTGCTGGGTCTGCTTCTAGTTTACTGCAATCAGCTTTTGC
TTCGTCAGCTTTTTCTTGGAGCTCCAACGATATCGCGATCTCTGTTTGTGCCAATGTTGCGAGCTCGACCTCAGTGAACTGGGCAAGTAAGTGTCGACTT
GAGTTTCGTTTCACGTAAGATGCACTGACGATGCTAGCCACCGAATCCGAATCGCCGCCGCTCAAATCCCCATCTCGTGTGCCTTTTGAGCAATCAGCTA
CGCTTTCTGGGCCACTACCGGATTCGATTAAGGTGATAACAGGACTCTGGGATAAAAGAAAAAGTCACTGAGCCCAGCTGCATTCCTTTTCTCTTTAATA
AAGAGAACCAGTGCTGCAAACCTCTTGAATATAGTTGCCGCGCATGCAATTGAGTCCCATATCTGGCAGCAGCGACAAATACTACAGGCACGAAACAGGC
ATGGGTGAACTACTCTCTTACTCGGGTGCAGGACAAACTGGGTTTTTCGACGTACATCACGCGTGCTCGGTTGGATACAAAAGAGTTTCTTGACAAATCG
CTTGATGGCTGTGAGATTCACAGAATGCGCACAAATTAGCCATCGAGAGTGGTGATACATGAGATGCCAACCCATGATCACATCCAGTACCTTTGGTGTT
GGAGAGAATCTGGTTGATGAAATGCGAGCACTCGGCAGCTTGAAGAGCGTTGCGGAAGCCGAACCCATAGACTTGACCAGTAATCCCCGTGAATTTGCGG
AAACTGCCGCCACTCACTTGCTCCCACTTGCATCCTTTGCGCACGATGTCGTTCACGATCACTTTGCCCGTGTCCAAGATCCACGCCACGATCCGGAATT
TCTTCAGCACGCCTTTGGTTTGTTTCGATGTCTTTTTCTGCTTTTTCGCGGAGTTTAGTTCACTTTTCATCTCCAGGAACAAGTGGATTTGAGCCCAGGC
GCCATCCGCGATCGGCGTCCATTTCATCGGCGGCTCGAGTAGGGAACTGCTCAGCGCGCGCTGCAGCAAGCCGTCGCTGCTGGCGATGTTAATCGTACTC
GCACTGCTCACAGCGGCGCTTGTCCTGTTTGCTTCGCTCACCTGCGTGACGTGTTCATCCATCTGGGGCTTCACGTTAGAGCTACTGGAGCTGCTGTTGT
TCTTGCTGTAGACGACTGCGATGGTCGTGTACACCACCACCTCACTACATATAAACAGCCACGTATGATCAGCACATTAGGAGCTTTAGCACATGGAGCT
CATGTAAATGGTAGTTACAGACACACCAATACCTCATTATATAGCGCACGTGTGCTGCTGGAGATCCGTTGACTACTCACTCGGGGTTTTCGTGTCTGTA
CAAAGGTGTGGCGATGGATGTTGAAGCTAGTGGAGACTAAAACTGTGGCAAAGCGCGCATGAGTCACTGTTTAAATGCGCTGACGAAACGCTTTGCGTCC
CTGAGACGCTTATAGAACGCATCCCCACCTGCCCATGCAAAAAACGATCGCGCACTTTGCATGCTTCAAACAAAAGCCGATCGTACTCGGCTCCCACAAA
GCTTTTTGTACAATATCAATACTTGAAGGGACTACACAATATCAATACTTGAGACTATTCTTCTAACGAGGTAGTTTTTCAACTACTGATTTGAGAATCA
AAATCGCTGCATGCTTGCTGGCACTGTCGAACTAGACAACTTGCTGTCGCCCTCATTTCTTGCGGACCTTTTTTCCTGCTGTTTGCGTAAATCAGTGCTT
CCAGTCTTTCCAGTTTTTGCTATCTATGGTCGTTGTATTCACTACCTAGTAGTGCCGTTCATTTATTTACTGAACTTGACGATACCGTAGCAGACGTCTT
CAAACGCATTGGCCTGAGTTACTAGCGCATCGAGCACGTCATCCTCCAAGGAACACCGCCATCGTCGTAATCGCACCAATTCAGTCACAAACGAGGCAAG
TTGAAGAGAGCTGTGGAGAGGATACTAGATGCATTTGGCCTCAAAACTAAAAAGAATAGCATGGATAATTGTAAGCATTTATTGCTTCGCATCATAGCGA
CTCGATTGTCTGTTAAAAGACCGAACATGAGCCGAGTCCAAGTGTGAAAGTCTCAGCTCTTGCTCACTCCCCACTCCGCGTACAGTGTATGTACGCATTG
TATCTCGTCACCCTTGGTAGAGCACCGCGGGTTGCATCCTGCGTACAAACCGATTCTGTGCAACTACATTTGGAATGCAACGAGCTCTTGTACCAGAACA
TCAATGGGCACAAATTGCCTCGCACCGTCTCCATCAACGGTGCAAACTGCGACTACTTTCCCATACGACCATCATTCCTACATCGAGAGTGCATGTGCAA
CTTCTTACAAGAACGACGGTCATGGCAGACGACGAGTGTTGTTCATGATCGGGGTACTGTGGACCGATGCCGAGTGTTACGTCGGAGAACTCGGTGAGTA
GCATGGTGCACCGATGAAGTCTCAAGCACGGCGCTTACCTACAATTGGCGCTACAAAGTATCTATTCTCGCTTCCCATGCCTAAATGGACAAGGAGCTAC
GTTATCAACAAGCCTCATCCTTGCTGTCTGCCTGCGCTGTCCTTCGTCATATTTCACTCTGTGTCCAGCGCATCATCGTCGTCTTCATCGCCTTCGTCAG
CCTCACGCGCATCGATGTCGCTCAGCATGAGCTGATACTTTGTCACGACACGCTGCAGCGTCCGGTTAGTTGCTATCGTCGGAAGAATGCGGGTTTTCAG
CACGTCGCGTTTGCGTTGATCCTACAAGAGGCACCGACCACACGCCAAATGGAGTTTTTGTAAGTTGTGGTCAGTTTTGTCAGCCTTTCGCTCCAATGTA
TATTTAGTGGCTGCAACAAACGTACCAGAACCATGGGATTCCACTCGCCT