Description :
From Genome Similarity Track
Location :
Scaffold_21:3686- 5143
Sequence
1457 bases(100 bases per row)
TTGAACGATACCGTCCGTGTGCCGTCGGGTGCACCGTCGTCCTCCCTGGCCAAAAGAAACCAGTGTTCTTTGTCGAGTGATGGGCGCGTCGTGCCTTAAG
CTGACCATACGTCCTGAATCGAACTCGTGACTCGCGTGAAGATCTCCCTGTTCTGCGCGAGCACGCGATCGAGACGCTGGGACACTTCATGTCGATGACT
CGCGACGAGAGCAAGAATTGCCTGCTCGTGGCGGATTGTCGCAGCCTCCAGACGCTCCTCCAATCGTGCTCGTTCACGCTACACCGCAGTCTCCAGACGC
TCCTCCAATAGAGCTCGCTCATGCTGCACTGCGGCGTCCAGGCGCGATCGCTCGTCACGCATTGCGACCGAGTGGCGCACAATAATACGCTCAAGAGTTT
CTACGAGGGACTCATCCTCAGCGGCTTCGTGAAGGGCACGGCAAAGCTCACGCTCACTCCTCAGGTCTTGCTCAGCTTCGTTAATTCGTATCACTGCGTC
AGCAAGCTCGATCTCCAGCTGCTGTTGGTGTGCCTCGGCTTCGCGGAGGCTGAGTTGGAGCTCGTCGATTCGGCGCAGAAGGGTCTCACGATCGGCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNATCGCGACGTCAAGAGTGCGCACAACGAAGCACTCGAGAATATTGGAGTGCGTGGGGTGGAGCTTCGTGGTGGC
GGGGCCGGAGATTGGCCGACTCGAAATGTAGAGACGGGAAGCATACTGATCTATGTATAGTGCCTTCTGATCGGATGAACATAGTATTTGGGGTTGAGGT
TCAACATCAACCTCGCGGTTGGGGTTCATGAAAATAGCTCAACGTTGGCATCTCTATTGCTTGGGAGCTGCTTTGGCAAATGTCCATCAGCAGCTCTCCT
CTNNNNNNNNNNGCTGACGTTGCGCTCGAGCAGCGAGCGGAGCAGCGAGTGGGCGTCCGCAGAGAGCCACTTGGGCAGCACAATCTGCGGTGCTCGAACA
GAGCCGTTAAGAATACTAAGAGTCCCAATGTCGTCCGACTCCATGGAGTGATCGTACTTTGGCTGTGAGGATCTTTTGCTGCACGTCGTTGTTGTTTTTG
GCACGGAAAGGGGGCTTCCCCACGAGCATTTCGTACGCGAGCGCGCCGAGCGACCACCAGTCCACAGCCTTTTCAAATTCGCCATTTTGTCATCAGCACT
TATCACAAAGCAGACAGAAAGTACGGAATGACTCACCGCATCGTATCCTTTGCCGAGCAGCATCTCTGGCGCCATGTACTCTTTTGTCCCGCACACCGTT
TTGAGAGCATCTCCCTACGCATACACACACAATCGAATGGGAAGAGGAAGCCAGTAGAGACGGTGAAAATCATGACCGCCTTACAAACCTCCTGGAACTG
ACGAGCGACCCCAAAGTCAGTGAGCTTGATGTGGCCTTCGCCCGAGATGAGCACGTT