Description :
From Genome Similarity Track
Location :
contig_13:368558- 369758
Transcript NameFunction/comments
g2430.t1hypothetical protein

Sequence
1200 bases(100 bases per row)
CTGGCAAATTCGGCATCGTGTTGATCTTTATCCGAGTGCAAGTTGAAGTGGTACCTGTCACTCTTTCAAAAGTGTGTCCCATGGACGCGCTGCTCGCGAC
GGCGCAGTCGCTGCGCTCGCTCCTGCAGAGGTGAGCGGGGGATACAGTAGCTGCGTAGCGTCGTAATGGCTAATAACATGGTGGTGCATTGGTCCATGGG
TAGTGCGGCGCAGGAGCTCGGAGACGATTCACTCTACCGGAACCTCTCACTCCCAACCAGCCAGGACGTGGGCTTCGCTCTGGACCACACGTTCGTGATC
CGGGCAGGGGTAGAACCATTCCCACGCGTCCGTGGAGCTGCGAGACGTCCATTGCACATGTAGGAACTAGAATAACAAGGTAGAGTGACGTAGAATTCGT
GGAGGTTGCTGATGTTGTTGGTGGTGACAGGGAGAATTGGTACATCATGTCATCGAGCGGCTTCTGGCTCGGAAACGGGGGAGAATTGGGAGGACGCCAA
CGTTTTAACCCTCGGGTATCGGGAAGTGACGCCCGGGGCTACTGGCCACCGAGTGGCGCAGTCCAATGGGGTCATGTGCTACTACCCGAACACTCTCGTG
GCTGCTCTGAAGAAGCCGCTGTGGGAATCTCTGCATCGGCTCATGGGGGACGACCTCCTGACGCACTTGCTATTGAACTACACGATTGTTGTGCAACTGA
AGGAAGCCTCGCTGTCGTATATGCAGGTAGAGTGCTGTCTGGTTGAGAAGGGGGTTGGATGTGGTGGCTAATGTGGTGCTTTGTGGTGTGCTAGCTCACT
GGAAAGAGTCTTCGACAACAGAAGCGACTGGGCGACGCGACTGCCACTTTAAAGCGAGAAGTGTCGATCAACCACGTGATGTATGCGAGGCATTTCCGAA
AGGATCGAGTGTTCGCGAGCTCCCACGCTCTAGTGAAAGCGTCCAAGACAGGCGAGCCGATTAGTCGGACGGAAGCTTCACGGGTCCTCGGATCCATATT
CCCAGACACTGCAGGTGGAAAGCGCTTGCCCAAGCGGCTGATTAACCTCATTCCAACGATCCAGGAGATGGTGGCACGATTCAAGGCGTTCAAAGTTGAA
GAGCTCGCAAGGAAGTTAATCCCAGTGCACGCTGGGTTTCGTAAGTTCATGGCGGATCATCCAAACATCAAGCGATGCTTGCGGAGAAAACTGCTGATGC