Description :
From Genome Similarity Track
Location :
Scaffold_72:36853- 38066
Transcript NameFunction/comments
g13589.t1hypothetical protein

Sequence
1213 bases(100 bases per row)
CGACGAGGACTAGTGAATATGGGCAACACGTGCTTCATGAGCTCGGTACTGCAGGCCTTGGCGCACAACCCAATGCTGCAGCACTACTTTTTCGTGGCGA
GGAGCCATGATACGACCATCTGCCAGCAACAGAGACAGCGACTGGTGTTGAAGAGGCAGGAGCAGCTTAAAGCGGAGAAAGAGAAGGAACGTGGTGATGA
CGATGAGGAGGACCAAGAGGATACCAAGCGCGGCCCGGATCCTGCCATCACAGTGTGTTTGGGATGCGAGCTGGCTGCCTTCATGGCGCTGCTGGTGCCC
CCTTCTGTGCCGCAAAAGACGCTGGTGGCGTCACCCATTGCGCCGCAAGGCATTTTAGAAGCAATGTGGAACGCGTTCCCGTCGTTCATTGGTACCGCGC
AGCATGACGCTCATGAGTTGCTCATTGCGCTGTTGGGTGGCCTGCACTCGCATACACATCCTCGTGTGTTCGTTCACGGTGGTGCGTCTCCGCGTTTTAC
TCCCCGTGGACACAGTTTGTGCGACTGTGCAGTGCATCAGCATTTTTCTGGCGTGCTGCGGTCTGAGCTCGCTTGTGGGGGCTGCGGCTCAGCCTCACAC
AAGTTCGACCCGTTCCTGGATGTGTCGTTGTCGCTCGATGATGGAGAGAAGCAAGATGCCAAGCGTGAAAAGAAGGCGTCTTCGGAGTCATCCCCATTCA
CTCTTAAGTCGCTGCTGCGCCAATTTGCAGCAGAAGAGGAGCTGCGCGGTGCCAACCAAGTTTACTGCAAACAGTGCTCCAAGTACCAGAACAACTACAA
GAGCCTGAACCTGCACACGCTACCGAACGTTCTGGTGTTCCACATCCGCCGCCTCGACTTCTATCGCCAGCAGAAACTGATGCAGAACGTGCAATTCCCG
CTGACAGGGCTCAACATGAGACCATTCACGTCCGTGGGCATCGACGAAGCCAGCGAACGCAAGAAAAGTGACAACAAAAGCGCTGTCCAGGGGAAAGTGG
AAGGCGACCAGAGCGAGTACATGTACGACCTCGTCGCCGTTGTCAACCATCATGGCGAGTCGGTGAACGGCGGTCACTACACGTCCTACGTCCGTGACGA
AGTCTCCAAATCCAACGGCCAGCAGCAGCAGTGGATACTTTTCGACGACGTCGAAGTGAAAGCCGTTCCCGCCGACGAAGTCGAGCGTTCACAAGCGTAC
GTTGCTGCTCTGC