Description :
From Genome Similarity Track
Location :
Scaffold_219:3685- 6026
Transcript NameFunction/comments
Phymu_g6988protein kinase, putative
Phymu_g6989hypothetical protein

Sequence
2341 bases(100 bases per row)
CTGAGCTCAATCTCCTGTGCGAACTCCTCCACTTCATCAGCTCGGTGAGTTTTAGCCTGTAACAGCCGCTTGACGGCCACTTGCTGGCCTTCAAACTCGA
CCAGCCACACCTCTCCGCACGCTCCTTTCGAGAGAGATTGCTTGAATCGAAGACTGTCGAAGGGAATACGTTTACCAACCAGGAATTCGCTTCTGAGGAG
GATCTGCAGCGTGGAATTCGATCCGGAATCGAAGTCACTAGCTGAACTGGAACTTGGCAAGAACTTGATGGTCTTGTCGACGCCTCGATGAGAAACCGAC
GTAGTGTCGGCGAGAGTTGACGTGTCCATAGTAAAGTCGCTCTCACGCGGCTCGTCCTCTTTAAAACTCTGCGGTCGGCACGTCTCTAAGCCAATGAGGG
AGTTTTCAAGTGCATCCGCTTCGACGTTCCGTCGTTTTCTCTTCACAAGCACAACAAGAGCCAAAATACCGATTACCAGTAACACCCCAGCGATAGGAGC
GACCAACGCCAACTTGAAGCCCCCACTACTGAAAGTCGCTGATGATGACTTGGACCCTGAATAGTCTTCTTTTAGCCAACGAGACAGCCAGGGTGAGCCT
TGCACCTCTTCCATTGCTGCTCGGACCCCCTCTGAGATGTCGGACTCCAGGTAACACGGCAACACTAAAGACCCATAGCCTCCGTTCTGTTGGACCGTCG
GACACACACCGTacgttgcttcttgctccagCTGTACCGTgtggacagcagccacaacgtATGAGGTGTTGGTACTGTTATCCATCCACTGGTGCTTTCG
TATCTGAGGCATTGGGACGACCTCAGGGTTGCCGCCGGTCATCCACATAGCGAGGTGGatcttgccttcttcgaaATCCTCAACGACACAGCGAGCAGCC
GTGAGCATTTGTTGGCCGTTGCAGAGCAAATTActgaagctcgagacgtCGTCGAATACGGGATGTGTGCAGTTCAACTCCGTACAGCCCACAGCGTTGA
ACTGGGACATCGGCACGGCCAAGTCCGTCATGGAGTGGCCGCCGACGGTCCAGACCTGGACGACCTTGttgtcgtacgtgacgacgaagccagAGTCCCA
CAGCAGGGCGCGCTGGGCGATGCCCGGGAGCTCATCCCACTGGAGATTGAGGCTGTTGAGGCGTTCCTGAACGGCGTCTGGTAGAGCCAAGTTGGCGTAT
GTCGGGGCTGAGCCACCGGCTTTGGCGCGCAGATACAACTGTCTGGCCAGGTCCGAGTTGGTGCCAtcgaaggcgaagaacgtGGCGTTGGTGGGCAGCA
GCGGGTCGTCGGTTGCAAGGCGTCGATACTTCATAGGAGAAAGCCGAGTGAAGAGTGAACCTGAGTCTGCAAAAAGTTTTTCCACgtacgtttttttttt
tccaaCGGATCGCTGCTCAGGGCGTTGATCTAAGCCATCGGTGGCCGGTGAAGTGAACCGCTGGTCGTTGCAGCAGCCTGAACCTGTGGAGAAGCGTCTT
GCTTTGAAACGCTTCTCCAGAACGTTTTAACCGAAGAGAACCCGACGGCTCGGCAGGACCGGTAAAGGACCTTTGCCTGAACCTATTTTGGCGCACTTCG
AACAGCAGACCCGACAGTTGGAGAGTGATGAGTCTGCTCGGTCCATCTGTAATCATTCAAGATTCAGTTTAGCGGCATACCGACGTATTGTTTTTCAATC
ATGTTTTTATCTAAGCTGTCCAAACCAAACTAACACTATTTAAACAGCTCTTCAACCTTCAGTTACTAATGGGTACATCGTGTGATATCTCACGACTGAC
CCGTTACGCCAACTGTACGTCAAGTCGCGCCTTCGACCAACGATTTTCCAGTCGGGGCCTCCACTTGACATCATTTCGGCTTTTGCCTCGCGATGCGTAG
GCCGATGCGGCCGACTTTTAACCTCCCGGTGCTGCTCGCAGTCGTTTTGCCTCTCGCTCAAGCTCACACCATGACGTTCCGGAGCCTGGAAGagacttcc
tcctcctccagttcgctcccgtcctcttcgtccgaCTACGTCTTCAATGGCTCGGACTCGGACATTgccaagcagctctggaTCCGCCACAAAGCAGGCG
CCAGCGACAAGCAAGTGGAACTCACGGCGGTTCCTAGTGCAGTGACCGACCGCCTTGACGCCATCAACGTCGATTTCAATTCTCTTCCTGGACTCGTCCA
ACGCGCAGTCCTGTGGGACACTGGCTTTGCCATTGCACCGGGGAATATACCGGTGCAGGTCTACCCCATGAACAACCGAACGATGGATAACATCGCCATC
CCCAAGTGGGAAGTCTCGGGGGTGCAGTGTACCTTCACCAA