Description :
From Genome Similarity Track
Location :
Scaffold_101:368471- 371693
Sequence
3222 bases(100 bases per row)
CCTCCTCCTCCTGACCCACACCCTTCCTGTGGGTCCTTCTTCATCCTCCCATCGACATGACCAACTCACATCCATGGATCCCCTTCCTACTCTTCTTCAT
GAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCGGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCTACCCAACTGGG
GTTCGTCATATCCACGCCGATACACCAGAAATTCACCGGTAAATCCGCCCGTATCTAGTTCGCTTCCCTGACCTCATGTCGGTGATCTTCTCGACTTCGA
ACTCGTCGGCCCCGAGGTCCACATTCCAACTATCCTCCGGCTGGAGGACTTCGTCGAAGTCTACCCGGTCGGATCCATCCACCGAAAGACGGGTTTGCGG
CCGATCTGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACATGCGATATTCGGTACCTGCCGTTTCCAGCTTTACAGCATGTTCT
TCTATCTTTTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCATACTCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATC
CCACTTGGATTTGGTGCGGACGGGTGTCTTCGTTGTGTCGATCTGCTCGATCCTTTATCGCACTCCGCAGCCGTTGGTTCACCTGGAATCTGGCTTGCCG
GTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGATTTCTCTTCTTGGTGCTACAAACTGGAATGGCCACTTCTAGGGTAGATTTGGGATCC
CACCCATGTACCAAGTAAAATGGGGTATCACCTCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGTCGTTCTGCGTACTCATCCCAATCCCTCT
GATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATCGTCTGCACCATGCGCTCGGCCGACCCGTTAGCTTGGGGACGGTATGTCCATGGTTGCCC
GCTGTCGCTGCCCCAGGATCCGGTTGAAAGCTCGAAAGAAATCAGACATAAAGCCTTGCTCCCGATCATGTCTAAATCATCTCGCTAGCTCCATATTCTT
CGGAAAACGCACTCCTCGTACGCATTCAGCAATGTGTCTGCGCAGTTTCTAGACGCACTAGCTTTGGCTACCACGTATCTCGGTAAACAGGTCCACCCAA
ATCAACAATTCTGTGTTTTTCTTTGAACGACTGGGCAACGAGGGGGTATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCTCAGGTG
ACTCCCCTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACACATTCCCCGACATACCGTTGTACGCTCTTGAAAAGTCCCCTCCAGTGAAAACA
TTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAGGCTAGCATGGTAGTGGTGTAGGACATCCTGTTGCAAGGTTTCTGGCATC
ACCAGTCTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAA
TACTGTAGGATTTAGTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCCTCGTTTTGTGCTTTGAG
GATCCGCTCAATACGGACTCTCTTCACAAATGTTTCCTCGAGGATCTGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACT
GTTCTTTTTATGGATCCAACTACCACCACTTCGTCTAGTCGGTTCAATGTAACGAGATCCTGATGCTCGGCTTCTCTCTCCACTTCGACACCACATTGAT
TCCGTAAAGCGGCGCTGGCCAAGCTGTCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCAACCAACCACGCAGGTGGATCATCAC
TTTCTGCCGTAACAGTGTTAGGGCCAAGGCCTTGCAGTCAATCTCACCTCGCACTTGTCTGATCACCAAATGTGAATCCCCACAAATCACCAGCCTTTTT
GGATCTTGTCCCTTTAGTAGCTCCAAACCCAGAAGAAGCCCGTTATACTCCGCTTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGACCCGTACAA
CTTCCCATCCGGGCAGTCTCCACAGTATTGCACTGTATGCTCCTCCTCTGCGTCGTACACGAGCGGATCCATCGAAACATAGGACGTACAGATCCTCATC
TACCTGTACCGTCGGGATCTGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAAG
ACTCCCAGGATCTCGTCTTCCCCTTTCAAACATTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCTAAACGTCCTTGTAACCCGG
CCGACTTGAACAGCCAAGCTAGCGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTGAGATCCAACACGCGCAGGAGCAC
GAGTATTTCCTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACAAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACC
AGAGCTGCTGAGACTGCCCAGTCACTGGCATAAACTATCACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGACAGGTGTGGTCGCGATTCTGTTCC
TCAGCTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTTTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTAGATCCTCTCTCCGTTG
GTCCCGGGGTGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGGCGTTGTACCACTTGGATTCCTTCGGATCCGACATCTCCCGGGCCAGAGCTTGTTGGAT
TTTTATCCGGACAGCTGAAGTGGTCATCGCAGCAAAATCTACATCTCTCAATTCATATAGTACCGCAGCGAACAGTGCGTATTTCTCGATGAACCGACTG
TAGCAATTCAAAGTGCCTAAGAAGGATTGCATCGCCCGTAACGACTGTGGGAAGGACAAGTCGGCTAACGAAGACAGAATCCTTAGGATTCGCCTCCAAT
CCCTCCTTGGACACTCGATGGC