Description :
From Genome Similarity Track
Location :
Scaffold_10:36845- 41063
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_10-snap-gene-0.24Dynein heavy chain

Sequence
4218 bases(100 bases per row)
AGCGCGTCCCGCGGCCATGGATAGAACCAGTCCATCGTGCAAGTACCACTCACCAGCACGGGGAATCGACGGCACCTCATGCGTAGCTCGTCGCCCACGG
GCGAGCACGCTAGCAGAACGTGGAGATTGGCGCGCACGCGATCATAGAAAAACGTTTGCAAGTGTTCCTTCGTGTCAGGAATGCCGCGTGCTTTGGCGTC
GACGCGCAGGCTCGAGGTCATGGCGTCCATTTCTTCGGGCGAGAAGAGGTCCGGGATCTCACATGTCGTCATCATGTCGTTGATGTAGATGAGAAACGTC
TCGTCGACGTTCAAGTGCGCGTCAGTCAGCATGAGCACAAGCGGCGTGGCAGGCCGCACGGCGGCCTTGCGGTAGATGTCCTTGAGATCTTCCTTAAGCT
CGGTCACGCCGTAGCGCGGTGTGGCACTGAGCGACAGCCCGTGGAGCGAGCATCCGCAAATAAAGGCCGCGAGCTTCGCGAGTGACTGCTTGCCCGAGCC
ACCGACACCGATCAAGAGGCCATGGCCGCGCGGGTGGAGCAGCATGCGAACAATCCGTGCAATATGCTCGAGCGCGTGGTCAAAGAGCACAAGGTTCAGC
ACGGGGTGGAGTTCGTTGTACGCCCTGAGGTGTTGCTCGATGGCCACCGTGAGCTGCAACTTATCGGCCACTGGGACATAGGCAATCAGCGACGTGCCGC
TCGCGATATCGTCGTCGGATGTCGGTCTGAGAGGAGAAGAGGACGAAGCAGACGCGACACTTGCACCACCACCGCCGCCAGAACGACCAATAAAACTCGC
GCAGACGAGCGGCGTCGCAAATACCTCGGACGGATCGTCGTCGAGGTGCTTCTTCGCTTGCTCGAGTGCCATGTCCGTGAACCGCTGTACTTCGCTGGCC
GTCGCCATGCGATCGCTAAACACGCGGTAACACTCATGGAGCCACAAGCGAGCGAGCATGAGTGTATTGGTCCTGTACACGTGCGGCCGTGCAAGAGCGA
GTCCTTGAAACAACGCTCCGAGGTCGCGCAGGCTGAACTGGTAGTGAAACTTGGTCGCGGTCGGGAGAAAGTTGGCACGCACGTCCGCGTACAAATCGAT
TGTGGCGGCGACGAGCGACGAGCCCATCTTTTGGAGCGGGTCCGAAAAGCCCTGCAAGTGCTGGCTCAACAACGTCGCATACATGGCCGTGAGGACGGTC
TTGCCGGGCATGGGAACCGCAAACGTCGCAAAGTGGCGCTGCAGACGCGACTGGACCGTAAACGACCCCGTCTTGTGGTTCATGCTGGCCACGAGTTGGA
CATCTTGGATGGTTTTCTTGAGCGTCAAGTCGTGGCGATCGTACCACGCACTGTACTCCATCCACTGGCGCAGCAAGGCCATGGGCGTCTGCGAGCCATA
CGACTCGACAAACGGCATATTGAAATCATCCAGAAAGTAGACGAGCTTCCGGTTCTGAAGAGGTCCAAACACGCGTCCAGACCGCTTCTCGAGATACTTT
TCCAGCCGCAACTGGAGCTGCTTCGCGTCCATAAAGTGATGCAGCACCACATGAGCATGGCGGACGTCGTCACTATCGAGGTTCTTCAAGTGGTCGCGAA
TCAACGCCGTCTTGCCTGTACCCGCTGCGCCGACAAGCAACACGGGGCACGACCGTGCCATCAACAGCTCGAGCAACGCATGCAAGCGCGTCGATTCCAC
GGTCGGCACGATGAGCTGGTGGAACGGCGCGTCGAGGCTGCTTGCAAACGGTGGCACGCGATCCCTCCACGGGACAAACTCGCTGGCCGCCACGTCCAAG
CAGATGTCAAACACACTCAGGTTGTGCAGCGATAAGGGTGGCACGGTTAACCCGCCGCCACCACCTGACTGCGCGCCTGCACCACCACTACTCGTAGTAG
ACGGTTCTGGGTACTTGAACTTTGCGAGGGATTTAAAGTGGGTCGAAAAAGCCTTTCGCTGATCAAGAGCTCCACCACCACCACTACTGCCGCCACCACT
GCCGGCACCACCAAACGCACCTGAGCTGGACCGTTCGTTGTCAAGTGCACCACCGAAAGCCCATATCGCACAGTAAATAAATACGTTTTCGACCGCGTCC
GGCGACTTATCTTGCTCGGGAAGCTGCGCCAACATGCCGTCGAGCAGTCGGCACAGTGTGGAGACGACCGCAATCGCAGGCAGCGGCACAATTGGTGCAA
GCTTGTGCTCCTTCATCATGGCAAACAGGCTATCAATGTACTTGCGAAACAGCGACGCCAGCACAGCCTTCTCATCTTCCTTCCCGTGTCGGCGTGCGAC
CCACGACTCTGCGAACGGCAGCCAGCCAATGTCCCCTTCACTCACGTAGATGATTCCAGCGCGAGAGACTGTCGCCGGCGTCGCGTTCTGCAGCGAATGC
ACTTCAAACATCATGCGCATCGACTTGGTGAGCGGGATCCGCTCGTTCGACACGAGCGTCAAGACCTTGTTGTCGTCCATGACGGTGTTCATCGACTCGA
TCCAGACCGCGTCAATGTCGCCGTCGAGCACGATCCACTTGTACTGCTGCGCGTCGCTGAACGGCGCCATGCCCTTGGACATGTTGCGCATGATAGACGA
CAGCACGCCATCCTTCCAGTCATTGTCGAGCGTCATGAAACCGTACAGCTCGTCGGCGGTGAGTGACTTGGGGTTGACGCTCTCAAAGACTGTTGAGGCC
TTAGCGAGTCCGTGATTGTGGCACGATGCAAGCGTCGACCAGATAGTGGATTTGCCGCACCCGGCTGGGCCAATGAGCATGACGCTGTGGCGGACGCGGA
GTACGTCCTCCAGCTCTAGTACTTTCTTCACAAAGCAGTCCTCGGGTTGCAGCTTTTGAGAGGCGCAGACAGCGACGCACGCGTCTCGCAGCGAGTCGTT
GGCCATGCGCGGCAGCGTTTGGCCCGGAAACAGGTCGTTCAAGAGGCCAAGAAAGACGGGGTAATCGGCAGGCAAGAGCCGTGGTGTGTTGAAGTCGCGG
AGCACTTGCATGAGCACGTTGTCTTCACTCGCTTGGGTGCCCCCGGCACGACGCAGAAGTGAGCCGGCGACCAAGAGCACCGACTTCACTGCACGTAGCC
CCCAGTCGTAGTGTGTCTGCTTGGACAGCATCTCGCAGCTGAGATCGTAAAGCGTCACAAACTTGACCGAGAGCACGCGCGCCTTGAGGAAGCCTTCGGC
CATGAGCATGTTTTCGCAGATGGGCTGCAAGTCCGGCTTGATCATCGCACACGATCGGAAAAGTGCCTTCAGGTTCTCTGGCAACTCGGCGCGGCCCGCA
TATCCTGGATTCATCGTAATAAACAGTCCGACCGTCGGGCTCAGCGCAATCGTCTTGCCGAAAAAATCGCATGATCCCATGAGCGGAAGCGACGCATTCG
AGGCGAAAAGTTGGGCCTGCGCAGCCGCGGCCGCCGCCATCGCCGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CTTCCTCCCCCGCTGCACGCAGAGACGACGCGGTGCATCGTCGCGGCCAGTGGAAGTAGCGCGTCCAGGACCGTCTTGACCTGTGTCGCTACGACCGACA
GCACTTCAACCGAGATACGATTGAATTCATCAAAGCACCCCCACGCGCCAGTCTGTGCGAGTCCCTTGAAGACGTCAGCCATAGTCTTGTAGTTCATCTG
ATCACTGCAGTTAAACACATAGCAGGGCAGCCCCATGCCACGCGCGAGGTCCTTGGTCGTCTCGGTTTTGCCCGTGCCTGCGGGACCCGCAGGCGCGCCC
CCGAGGCACAAGCGGAGAGCGGTGGTCAAGGTGACGTAGCACCGATCCGTGAGCGGAGTGATAACGATACGCCCGCAGTTGCCTGTGTACTCGTAGCTGT
AGAAGGTGCGGAAGTCGCAAATCTTAATCACAACCTCTGTCTTCTTCCTCGCTCCATCCATCGCACCAGCAAAGCCACTATTGCTACTGTTGCTGCCAGG
CGCGTAGCAACGCAGCTGCGACTGCCACGGAAACTCCAATGCACTATTCACTTTCTTGGCGATCAGCGACTGCACGACGTCACGCGCATGCACGTCAATG
GTGATCAGCGTGATGATCTTGGCACGGTCCAGAGGCGTCAGAGAGCTGCTTTGGACCAGCTTGATCAACTCTTCCAGCCGCACGGTGGATACATCGACGT
ACTTTTTCAACGCATCTT