Description :
From Genome Similarity Track
Location :
contig_49:368359- 369364
Transcript NameFunction/comments
g9756.t1hypothetical protein

Sequence
1005 bases(100 bases per row)
ATCATGCACAACGCAGACGTTGGCAAGTTTGCTCTGCGTTTCAGACGCGGTTTCTTTCAGGACGGATATCTCCTCTCTCTGCCGCTCCAGTTCTTCTTGT
TGAGCGCTTTTCAACTTCTTTAGCTCGTTGAGATCACGAAGTTGGTTTCGGATGAGCAGCATCTTCCATAACGCCATCGCACGCTCCTGCTTTCTCCGCA
GAAACTTGCGTATCCAGCATCGAAAGCGTTGGTTGCGTTCTTCCTCTCGGACTTGAAGCAGCACAAATTCCGCCCAAGCGCTGAAGCACAGCTGTGCAAC
GCGCGTCTGCTGGAACAGCATCAGTTTTCGCTCTGCTTGGCGACGCGTCTTTCTACTCTTGACGGTATCCTTCCACTCGGAAAAGCAACAGCGCATCGTT
GATACCGATTGCTTCCACCAAACCTTCGCTCGAATCGCAGTAAGCGCCACATTTCGTTTTTCAACCTGCTCTTTTGCTGCCTCCGCCCTCGTAAGCGCTG
CCCAGTGCGTGAATTGTTGCCGCATCTTTGCATGAACAGACCCCAGCCAGATTTTCTCTAGCGTCCAACGCAGCGAGCCATTCCTTCTAGCTAGCTTTCT
CCATTCCGAAACAATACCTCGGCAGATGTACGTCTCCGAGTTGCGGACAAACAACGTTGAGAATACCTGTACTGCTCTGCGCCGTCGCCTGGCATCTTTC
CAAGCCTCCAAGCATTGAATCTGCCACCAACGCGAGAAACAGGACTGAATCGTCCTGTGAACGGCCTTCAACCGTTTTTGCTGAGTACTGAATCGCTTCC
ACTTTGACAAAATTGCACGAGTTTGGTGGACTTTCACTGCGGTCTGGAAATCGTGCACGAGTCTACGAGCGTAAACAGCTTGGCGAACGACTTTTTGCCA
CCTTGAAGCATCGTACCAGTGTAGAACCTCTTTCCCTAGTCATACACAACATTTCTACAGCACCTGTCAATCGTTGTGCTCGCTTTGCTTCCTCGTAAAG
GCGAG