Description :
From Genome Similarity Track
Location :
Scaffold_34:368328- 369980
Transcript NameFunction/comments
Phypa_INRA-310PPTG_12866hypothetical protein

Sequence
1652 bases(100 bases per row)
CCACAGTCCTGCTTAGAATGCAACAACAGAAGTCCACTGTGATGGAGTGCAGAGGCGGCAGCTTGGCGAAGAATCAGAGGCTGGTTCTCGTCGGACCGCA
GCTCGATCTCCTTGCACAGAGTCTCATACAGCGCATTCTTCTCGGTGTTCTGGCGATAAGCCATGAGAGCTAGCAGCTCCAACGCTGGCGCTAGAACTTG
AGTGTCCGCCGAGATACTTAGAGTACGCGTTAGCTTGGTCTGTAGTTGCGAGAGTAGAGTCTGAGAGTCCGGTATCGCTTGATGAAGCTGGCAACGCACC
AATACCTTCAGTTGTCGCGCTCGCACCTTCGGGTGTGTCTCGGTCAAGAACTGGCCGATCAAAATCGACTGCAGCTCAGCAACAGACTCCGAAGTCCAGT
CTTCGATCACCAACTTGTTCGCGAACTGCTTGACTGACTTTTTGCGGATCTGGAGCACGTTAGACACTAGCATCTTCTTCACAAGAGCATCCAGTTGTCG
CCCAGTCCACAAGCTGAACCAGATCGCCACCAACGAACGATCCAGCACGTACATCCCCGGGCGTGTAGACAGAAGCACCGCAGCATGTCGATCTGAGTCA
CATCTCTGCAGCAACTGCCGATCAACTTCAGTTTGAATTAGTTGAGCCGTTTGCACCAACGTTTCTTTATCTGAGTCCGTCTTCAACATCGCAACCACGT
TGGCAGCGTCCTGTGCGTAGAACCGCATCACCACGCTCACAGTCGCGACGATCTCGGATCGGATAGCAGGGTTTACAGCTCCATTCTGCTCTGTCCACAG
CCACATGTTAGAAGGCAGCAACTTAGCTACAACGACCTTCAGGAACTCAGCTTGTGCGTCCTTCGAGACAGGCGTGGATTTCTTTCCAGCACCTCCAATA
GCCAAGTATTTCGTTGTAAGATGGCGGATCTGAGCGAGAATTCCGTGGACATAGTTGTGTGACATAGGCTTCGCAGTAGACTGGTCCTCGGTACTGCGAA
CGCCTTGAGGAAGCCGGGCACAGAGCATGGATAACACGTAAGCAGCGTCAGCGTTACTCACGATAGACGCCACGACCTTGGCTGCCATGTGTCGAATGGC
CATCGTCGGCTGCGACGCGCACTTCATCACCAGAGGAACGAAGCTCGCCAGTCCAGTGCCGTCGCAGGGAGAAGCAGGAGCATCCGCTACACGCTGATCA
TCCTCGTCACCAGGTCGTAAGCGGCTTAAGAACAGCAGCAACGGGTACAGTCCAGGCGGAGCAGCTCCACCCAGTGCACTACTCTTCTTGTCGTCTGCTA
GTAACCTGGTCAACTCACGAGCCAGGAAGCCACGGAGTTGCTGGAAACGCGAGAAGACGTCGTCACTGGCGACTTGTTGACGAGTTCCTCCGTCCGCAAT
GCGCTTGTCTCCAATCGCACGCTGTGTAGCCGCTGCGAAGAGCATCATGGACGAGTTCCGCACCGCCCACGACCCACAGTCGAAGCCACGCACTGCCAAC
TCGAACATGTCCACAACATATCGAGCCACATCCTCCGCCAGCACTCCGTCTTGACAAATGAGCTTGAGGATGTTCAGTGCGTGGACACGGGCACGCCACA
GCGAGTGGTGTTCCTGATGGGTATCCCGCTTCTCCGCGGCGTCTGTGTCTTC