Description :
From Genome Similarity Track
Location :
contig_49:368324- 369329
Sequence
1005 bases(100 bases per row)
AACGAAGACGTTGGCAAGTTTGCTCTGCGTTTCAGACGCGGTTTCTTTCAGGACGGATATCTCCTCTCTCTGCCGCTCCAGTTCTTCTTGTTGAGCGCTT
TTCAACTTCTTTAGCTCGTTGAGAGCACGAAGTTGGTTTCGGATGAGCAGCATCTTCCATAACGCCATCGCACGCTCCTGCTTTCTCCGCAGAAACTTGC
GTATCCAGCATCGAAAGCGTTGGTTGCGTTCTTCCTCTCGGCCTTGAAGCAGCACAAATTCCGCCCAAGCGCTGAAGTACAGCTGTGCAACGCGCGTCTG
CTGGAACAGCACCAGTGTTCGCTCTGCTTGGCGACGCGTCTTTCTCCTCTTGACGGTATCCTTCCACTCGGAAAAGCAACAGCGCATCGTTGATACCGAT
TGCTTCCACCAAACCTTCGCTCGAATCGCAGTAAGCGCCACATTTCGTTTTTCAACCTGCTCTTTTGCTGCCTCCGCCCTCGTAAGCGCTGCCCAGTGCG
TGAATTGTTGCCGCATTTTCGCATGAACAGACCCCAGCCAGATTTTCTCTAGCGTCCAACGCAGCAAGCCATTCCTTCTAGCTAGCTTTCTCCATTCCGA
AACAATTCCTCGGCAGATGTACGTCTCCGAGTTGCGGACAAACAACGTTGAGAATACCTGTACTGCTCTGCGCCGTCGCCTGGCTTCTTTCCAAGCCTCC
AAGCATTGAATCTGCCACCAACGCGAGAAACAGGACTGAATCGTCCTGTGAACAGCCTTCAACCGTTTTTGCTGAGTACTGAATCGCTTCCACTTTGACA
AAATTGCACGAGTTTGGTGGACCTTCACAGCGGTCTGGAAATCGTGCACGATTCTACGAGCGTAAACAGCTTGGCGAACGACTTTTTGCCACCTTGAAGC
ATCGTACCAGTGTAGAACCTCTTTCCCTAGTCATACACAACATTTCTACAGCACCTGTCAATCGTTGTGCTCGCTTTGCTTCCTCGTAAAGGCGAGCGTT
CGTCG