Description :
From Genome Similarity Track
Location :
Scaffold_39:368321- 371174
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011947Similar to Sgk2: Serine/threonine-protein kinase Sgk2 (Mus musculus)
Pytul_DAOMBR144PYU1_G011946Similar to NAB3: Nuclear polyadenylated RNA-binding protein 3 (Saccharomyces cerevisiae)

Sequence
2853 bases(100 bases per row)
AATCTTCTCGGCCAGATTGTTTTCAGCAACGGATCGCTTTGATATCACTTTCATCGCGTACAGCGCCCCATCGCGGCGATTGCGGACGAGCACCACACGG
CCCCATGCGCCGACACCGATCACCTTGAGGTACGTGAAATCGTCCGGCGACATCGGCGCGTCCACTGCCGAGCAGCTTTTCTTTTTCAAGTGGAAACTGC
TGCTGCTCCTGCTGCTGGCTCTGTCGCGACGTTTATTTTTCGCCGCTGATTGCTGGCAGCCCTGTAGCGCAATCGCTTTCGCTACACTCGCCCTGCGCTT
CACAAGCAGCAGCTGCTCGTCGCTGTCGACGACATCGGTCGTAATACGGCGAATCTTGCGCCCCAAAGGGTCTAGCGCACTCGGCAGCATCACGAGATTA
TCGCGCACCGGATCGTTGCATCGTGCTGCTGCCTTTTCCGCATCCTGTGGTTCCGTCGACCTGCTCCCGCTGCTTCTCCTGTGCTGCTCAGTGTGCGATC
GAAGCATCATGTCGACCACCTCATCGTGATCGCGATGCCGTCCACACGCCGCCGTGTGCGCGTTGATCACGCTCGCCGAGTACTCGTGCCGATCGAAGCG
CGTGGCGCTCCATCTCGACGCGCGTGTCATGGGCGACGGCAGTGGCGAAGAGGGGCGATTGGTGGCAGTGGTGGTGGCGTCGGCGGACCGTGTCCGCGCT
CTCGCGGCAGTCGATTGGCTCGTGCCCATTCTGCCTGTGTGTAAGTGTGTGTGTGTGTGGTGTTGATGCAGCTTGTGTGTGAATGTGTAGCGTGCTGCTG
CTGGCTGTCTGCGCGTTTGGACCCACCGCAATCGCTAATTATGGACAGTCAGTCAGTCTGCCTCCATTACCAGTCAGCATTTAGTCGTTTGTTTTGGGGT
TTGTATGGAGCATCTGAGAAAAAAATTCTCTCACAGCCTGATGATGGTGGTGATGATGATGATGGACAAAAGGGTCCGTTATTGCACTTGATCACAGTAC
TATCTTCCACCACCTACGTGTGTCGATACGGGTCGATGAGCATAAGATCCACTATTCAATGCATCTACTGTACTATTGATTTTACCATCACTCTTCATTG
TATATGTGTCGTCACGGGTCGTTGCAGTTGTATACACCGTGTTTGGGTACTTTCGGAAAACCGCTCACCGTATTGTGTTGGTTGCCCTTCTTTCGCTCAT
TTTGGATTTTGCACTCAACTGCCCGAATATGGTCAATATGGCGGCGCCCGCACACGTCAAGATGGAGCCGTTGGCGCCGCGACCGCCGCTCTCGCGCGAG
GACTCGCAGCGCATCCAGTTTCACTGCAGTATACGGCTCTGGAGACTCGAGGTGCGCTTCCTCGCGCAGAAGCTGCTCTCGCTCGGCCGCAGCTACGAAG
TGCGCTACCGACTACCACCCGTCGACAGTGCTTCTTCAAGCGAGCTGCCGTTGGCCGATTTCGGCTTCCAGGTGATGTCGCTCATGGACTCTCACGTGCT
GCAAGTCAAGTCGGTGAATGCGCCGCGCATCGCGCAGCAGATCGTACCCGAGAGGTCGTTTGTGGGCATCGGCATCCCGCGTCCCGAAGAGATCCGAGCT
ATCCATGTGGAAGACTACCTCGTGGGCATGAACACGCAGGACTTTCTCGTCGTGCCTGTCCCGTTGCCGCAGTTGAGGAAACAGATGCAGAACTTGCGGG
CGACACAGCGAGCGGAGAAGGAACTGGTGCTGCGCTTTGTGCGGTTCGATCGATTTGTGCAAGTCGACCAACAGCGCACGCATGGATATGTGCTCGATGT
GTTGAAGCACATTGAGACCAAACACGCTGAATTGGCGAAAACGTATGCAGCGTTGCTCGATAAAAACCGAATGATTGTGACCCGCGAATTGACGCGCGAG
AAAAAGCTGCTCGCGTACGTTCGAATCATCGCAGTGGAGACCCGCAAAACAATCATGGAGGATGAACGATTCCAGTTCGCATTCAACTTTCAGCAATGGT
ACGCTGCGATTAACGAGGTACAAGACGAAGATGACTCCTCTAGTGACGAAAGCGAAGATGAAGAAATGCAGGAAGAGCAGCACAACTTTGAGTACGACGA
GATTGAGATATCGGACGATGACGATGAAGAAGACGGCCGCATGCAAGAACAGCAGCAGCAGCATTCCGAGAATCTCGACGTGGTGCATCTCACTACAAAT
GAACCAGCAGCAGCAGCAAAACCGTCCCGTGCGAAAGCAGCTCAACCGTTTGCACGGAATAGTCAGCGACCCACTCCGCCTCAGAAACGTATCCAGCCGA
TACCGAAGCAGCCACGTCCCGTGCAACAACAGCCCGTTGCAAAACCAGTTCCGAAAAAACCGAGTGCTCCGCGCAACATTGACATGACCTGGGTCGACTA
TATTGCGTCGCAGGATCTGAAATGGCTTCCTCACGCGAAAGAGTCGCTTAGGAATTTCATTGCCGGTTTGATGGACAGCTTCGAGCAAGAAGATTTCAGT
CACTCGAGGATTTCAGAGATCACGAGGTCTGTCGCGGAACAGTTGCTGCATCTATACATTCACAAGCGGCATACGCTGTCGATTGATAATTCAGCGCTAC
ATAAAGAGTTTGCGCGGCATGTGCGCATGCTTCGGAGCAATTTGAAGAACCAAAAGAATGTCAAGCTACGGGAAGATTTGCTGAACGGCGCTGTGACCAC
TCAAAGGCTTTGTGAGATGTCCAGTGATGAATTGGCGCCAGAAGCACTCCGACTAGAGCGAGAGCGGCGATATGAACAGCATGCACAAAGTAGTATGCTG
AAAGCCCCGACAGGTCCAACCCTTGTGAAGACCAAGCACGGATACAAAGAAGT