Description :
From Genome Similarity Track
Location :
Scaffold_418:3683- 5322
Sequence
1639 bases(100 bases per row)
GCGTAACAAAATGTGGTCGAGCGTTATGAGGCAGATTTTTCACCGCGCCATGGCTTAAGTGAGTGCTGAAAAGGCACCCTCAATTCTTTGGCTTCTCACT
GATGGCGATGTGGTTCTTGCAGGCGCGGCTGCAATATCAGGAGGCTCTGTCGCTGGCTGACGAGAGAAGATGCACTGGTATTTTCTCTCGAACTATGGGC
ATCCCTTGCGCACATCAAAACAAGAGTATCATAGCGGCTGGTGGGGAAATCGCAAAAGCACAATATTAACAACAATAGTGGCTTAATCAACCGGTTCCTG
AAGAGTTGAAAGAGGCATGGGCTAAGCCGAGGACCATCTGGTAAAATATGAGTGGTATCCTGGAAAGGGCTGCAAATTAAGGTCCTCATCAAAGGCGTAT
CCCGGAAGAAGCGTTGATGAGTTTCGAACCGGAGGAAGCGTTCACCATCCGCGATCCTGCCATTGTCCGTTCGCGCGGACGACCGAGCGGTGGTGGGAGG
GGTAACAAACCTTCAGAAGAACACATCAATGCGCGCTCCTTCTGCATTTGAGTAGGTGTTGGATGGTGGGAGTCAGTGTAACAGGGAAACGGTCGCCTGT
ACTGTCACAGTACAAGCGACTTACACTGAAAACAGAGTAAGGTGGTGCCTCGAGATTTCACGTACACGTGTCGTGCGGAGAAGGGTTTCAACACGAGAAA
AGGGTAAAAGTAGAACTGTAGTTAGTATAATTAATCTCTTGTCAGTAAATCCTGTTTAGTTTTTATTTAACTATATCTAAATACAAACACGTATTGTAAC
TATCTGCTCACCACTCATTGCGTTCTTCTGTCGTGGATCGGCTTTATTGGTTGACATCGTTAATCTATGTCAACCAATGAGCAGTGTATTACTTCTGCAA
CACAATATTACTTATTTATCCAATATTGTGAGAACATTCTGTTTGTCCTAACAGAATATTCGTACTTGATATTTATCTTGTGTAAACTATCACGTAACGG
AAGCATCCCGTTACATCACCCCCCCTTAACCATCAGTCACATTAGTGACTGATTGATGAATGACTGACTCCAATGAGTGACTCTGGGAAAGGGAAGCAGT
TGTTGGTCAATTCCAACCATTCCTTCGTTTCCCCGGATGGTTATTAAGTCCATGCGGCGTGCAGAAAAAGCTGCTAAAAACGCAGCGATGAGACTACAAT
TTACTGCGGCGGATGAGGCAAAGGCCGTGAACGTAGCAGGCGACATCTTGTCTGCTGCTTCTTCTGGTGCAGGCTCACGCGGTGATGCACCGCGTGGCCT
CGAAGTTTACTACCTCGAGCTGATATACTCTGGCGAGTCGGACAGCGACACCGAGTCGACGAAGACTGCCACGAGGACTGAGCTGAATGAGACGACGACA
GAGCCGAGCAAGTCGGTCTCGCAAATCTCCATGAGCCTCGCTGAGCGTCGTGACATCTTCGGATCGTCCGACGAGTCGGAGGCTCTGTCCCCAAGGCTGA
GTCGTTCGCTTGAGAGCAATCAAGGCGGTGGCAAGAATCAGTCGAACTATGATTACGGTGTCGCAGTAATGCGTCACAATCAAGACGATCGTGCTGGACG
TAAGGTCGGTACTTCTGTTGACAACACGCAGGAAGCCAG