Description :
From Genome Similarity Track
Location :
Scaffold_1058:3683- 4818
Sequence
1135 bases(100 bases per row)
CAAGTGGGGATTTCAGACATCGCCACTTGTTCGTCAACCTTCCAAACGATTGTTCGACCTTAATGCAAAGCTGGTTAATATAGAAGTCGTACCGTACTAC
ACCTACCTCTTGGAAATAGATGGAGCTGAGGAGATTATTGGCGGGGAGTGGCTGTACGAATCGAACGACAACCACCCGGACTTCCTATGGATGTCGGAAG
GAAAACCGGCTTCGGATGTTGTCACCCGCATTGGTCTGAGCTATGCAAAcgtgacgatgctgctggagaaagCCGTGGCGTGCTCCGAGCCGACGTCGCC
TTCAGTGATTACGCAAGGTGCGACGGCGTAGGTGTCAGATGGAATGCCCAAGCTTGCTTGTGTATTTGGTGGGTTGCCTTCGATCGACCCATTGCGAAAT
CGTCTTGGTGGCAAGCTTGAAGTCAACGCGAGCTCGAGGATTTTACCCCAAGAGGAAAGCGAAACGAGAGAAATAATCACTTGCATATACGACGAGAAAA
CAGTCTGCACCTTTACCACCCCTATTTTGTCAAGAGCAACTTACATTCGGCAAGAGCAAAAAGCAAGATCCAAAAGAGCGAAGGCAAGTTCGTGAAAATC
GCTTAAAAAATATACCCGCAACAATGTTATACAAGGAAAAAACACTAATATACTTGGGGTAGCATGGCTACCTCAGGTTTTCACCGGCATGTCGTGTAAA
TCGCGCACATACATCGATCTTGTACCGAGATCCTCGGCCACAGCTTCCCACATGCCACCATTTTGTGCGGCCTTGATGACGCAGAGCTTGGTGTCGAATG
CGTACCGCGCGTATTTCGCCGACTAATGCCATGTTGAATACGGGGGAGCTCTGGTTTTCACGATCATAATAACTATCAGTGTTTATTTACTCTTTAGTCT
GGTTCAGGTAGTTTCAAGcataccccccccccccccccccccccccctgcaCGATTTAAGTTCACACATTTGGCGCTAGTATCATGAAAGTAGAGCATAT
ATTCTTCAATagcggtacatgtaatgtaAGCCGCCAAACCAAGATGGTAGCGCGTCAAAAGCGAGGCTAGAAGTATTGTAAGAACTACAAGGATATAGGT
TCCATAACATATGTATAGTTTCACCCGGATCACTG