Description :
From Genome Similarity Track
Location :
Scaffold_8:36828- 38169
Sequence
1341 bases(100 bases per row)
GCACGACGATAATGGCGTGGTATACATATTCTCGACCTTCGTGCGTCTCGATATCGGGGTTAGTGCTTCCGACTGGTAAGGTGGCTTCCAAGTTGATCTT
GGGCCCCAACCTTGAATCAGGTAAAACGGTGTGTCTCCACAAATTCGATCATGAGAGGTGTTGATCGCATAAGTCAACCGCTCTGCATATTCGTCCCATC
CCTTTTGAATTTCATCGATGAAATACATCTCGATCGATCGAGTCAGTGTCTGTACCATGCGTTCGGCCGTACCATTCGCTTGCGGTCTATATGCCATGGT
GGCCAGCATTTTGTCCCGCGATCCGATTGAACGCTAGAAAGAAATCGGATATAAATCCTGGCTCGCGATCATGAAGTATCGCCTCACTCGCACTGAATCG
TATGAACACGCATTCTTCGTAATTTTCCGCGATCGTCTGTGCGGATCTGGACGAGCTTGCTTTCGCGATCACATAACCCGAAAATAAATCGACCCACAGT
AACAGCTCGGTTTTTCTTTTAAAAGATCGTGACAACGAAGGGATGTGATCCATAGCTATAACCTGAAACGGATAAGTCGATTGCAAATTACCAGGTGATC
CACTCCGATCACCTGGTCGTCCTTTTCCCGTTCCACAATCCACAATCCACATACTCTCCTACATACCGCTGTACACTTCGATACAACCCACGTCAGTGAA
AGTTTGCCCTGATCCGTTGATAAGCACGGTTGATTACTTGATGAACACCCTCCAAACTTGTGTGGTAGTGGTGCAAGAAATCTGCTGCAACTGCTCTGGA
ACCACCAGACAAGCCAGTTCAGTAAACGTTCCTCCAATTCGGTGGCCGATCTTGGACAGAAAAATAGCAAACCATTTTGGTCTACTTCATAATCCTGTTC
AATCCGGGCGTTAAACTTTGACTTCAGTCGCCGATAATTTACCCACATCTCCAACCAGATCTATCTTCGGACTGGATAGCCAATTTTCTTCGTCTTGTGC
TTGCTTAATGCGATCGACCCGTATCTCCGGCACAACTTCTTCCTGCAAAATCCTGGGATGACATCGTCTTCTTAAGGCTGATCGAGTGATAGCCGCCACT
TTGACTGCATGATCGACCCGTTCTGGTAATAGTAATTCCCCTAACCGATTGAGAGTGATCAGATCTTGACGATCCTAATCCGAAATCACAACAGTTCCTT
TCCCTTGCCTTAGAGCTTCACTCGCCAGCCAATCTGAACCCTGATTCAATTCCCGCTTCATATGCAGACATTCATGACTGGCCACGATCGGAGTTTCTCC
ATCGCTCTGTGTCTCAGCAATTGTGGTCCTGATGCCTTACA