Description :
From Genome Similarity Track
Location :
Scaffold_791:3681- 10412
Transcript NameFunction/comments
Phyta_totarag10733hypothetical protein
Phyta_totarag10734hypothetical protein PHYSODRAFT_506739

Sequence
6731 bases(100 bases per row)
ATTGTAGTTTTTCGATTTATTCGAGTTTAACGCCTAGGCGTCTGGTACGGGGTAAGACGGTAGCTTTGCTGAAAAAAACTTTCTCTTTTTCATCTATTTG
GACTTCAAATGATCACCTCTCCGTGTCAAATTgactacagtacatgtacatgtaatagtGAATTTGCAGACGTATTTATCGTAGTCACGGATAGTCTATG
CTGGGTAGTCTTGTAGTCTTGTATAGTCTGTACTTCGGTGCTGATTTCTTCATGCATCACGACAAAAATATGTTGATGTAGCTCGCTCAGGCAGCGGAGG
ATGAATTGagttcctgctccagctcacgCAGGAAGACAGCGAGGTAGTCTTGATCCACACGTCGCATGGTGAGCTTTTGTTGTAGGGACACGTAGCCAGC
GAGCTTGAGTAGCTTGATAATGCTGGGCGTGGTCTTGAGCATCTTCGAGTAGCGAAtgtcgtcgtgctgcagtGTGCGGAACTTGGAGCGCACACCCTCG
CggtgcagcgagcgcagcaccTTGAAAATGGAGGTAAGTTTTCGGGTCCGCTCGGTGTCGGACGGACACtcgcagcggcagcttgccAGGCACGCGCGGA
TTTCGCGTACGGCCTCTTCCACTTGGTGAGCTGTCGGGACGCGATCAGGAGCGTCGTCGCTCCACGACGGCTTGTCGTGCAGTGGCTCGCCAGATGAAGC
ACCACCCATTTGGCCGGACTGGAATGGCAGTGAAGAACTGCGCGGACGGACAAGACCTGCCATCAGCTCTCGAAGCTCGTCACGCTCGTCCCTCCCCACT
GCGGGAGCTGGAGGTAACGGTGAGGGTGGCGATGCAGCCGGGTCGATCGGCGGCGACGTGTTGGCCTCCGCtgccttccgcttcttcagtAAGGCGTTCA
GGTCCTCCTCAACGAAGAATGCGTCGGGGCCCTGGTACTTCTTGAACTGAGGCTCGCGGAAATCATCGCTGCTGAGCAACGACAAGTCATCGGATGAATC
GTCGTAGCTCTCTTCgtcagacgacgatgacgcgtAGTCATCGTCGCCGCCGTGTCTGGTGCCTCCCGTTGTGCCTAGAGCCTGCAGGTAGGATCCCTCG
GTAGGCGAAACAGAAAGTCGGTTCGGTCCGGGTGCTTGGCCATGTTGGTTCTTCTTTATGTTGTCGTGACTGTTGTTCACGTCACCATTCGCTGAGCTTG
CTTTGGGCTTGATTGGCTTGTGTAATGAGGGGCGAATGTTGTATTCAGGAGACACCAGCTTCTTTCCAGTAGGAAGCGGCGGTGATACTGGgggcggcgg
aggtggaggactGATCGGAGTCTTTGCCACAGTCGGAGGCAGCGGTGGGGTCGACGATCTAGACATAGACTTCCGTGAGCCACCGCTAGCACGCACAGGA
GTCTCACTGGACGCCATCACACCACGCAGCTCTGACACCAGGTCTTGTGTCGTTAATCCACGCGCGCCCATTGCTTCAGACGGCAACGACATTGCCCTTG
GGCCCGACGACACTGATGAGGCCGTGTCGCCTAGGATAGGACTGTTCTCTTCACCTCGCTCGCCGAAGATCTCGAAGACGCTCTCAATTTCCACCTGTGC
CGAGCGATCTCGTACAGCATCTAGCCGCTGCCGTGAACGTGCTTCTGGTTCCGGCTCGTCGCTATCGATGACTGACAGTTTTCGCTGTGCGTCCTCAAGG
CTACGCTGCAAGTCGacgatcttcttctccagctcatgGATTTCCGTGGCGCGGCGTACAGAATTCGCGAAGTTTTGTctatcgtcgtcgtcttcatgct
CCGAACCATCGTGTTCTGACTGATACGTTGCCATGATCTTCTCGTAGTTAGATGCAGAGTACGGGTCGGGACTCTGAGCCGAgctgtcatcgctgtcgtA
TACTGTTGGATAGCTTGCTACTGATGCCGAGCTCGCTGACATCCCATCATCATCATGCTCCTCTTGACTATTTTGAGCATTGTTGTCTTCGTGCGGCAGG
TGCTGGCGATCTCCTACAGACAAGAAGGCCTGGCCAGCCTGTCTTGTGgcccgagctgctgcgaacGTGATGCGAGCGACCGAATTAAACTGGTAGGCCG
TCATCTCACCGTCCAGTTCACTGCCACCATCTCGTAGTGAGTCTTGGCTACGGTCACTTGGTCCGGAGTAGTACATGGCAGGCGCCGCATTCGTAGCGTT
GGCcagcgcagcatcaaagTTCGAGACGGagctctccagcgcctcaCGAATACTCGTGATCTCGCTGTACATGTCGTTGAACTCCTCAATTTCGTCGCTA
TCCTCGTCCCGCCGTTCTCCATATGCTGCCTCAGACATTGTAAGGTTAATGGTGTCACGAACCTCGCGGATATGGGTCACAACATCCGTGAGGGCTTGCA
TCTTGTCCTGAGCGCGCAATTGCGGGCTGACATCAATTTTACGCGGGGGATTAACAGGTTTCAGCTCGGTGTCAGCTTCAAGGACTTCCATGGCAAGGTC
ACTTTGTCGACGGTCGCGATCGCGCGACTCACGCATCTGGAAAATCATATCCTCGTAAGAATTGTGCTGCGGGCTACGCAAGCCGCGGATGTACGACTCC
GTGTCGTTAGACGTAGAAGACGCGGGTTCATCTCCAGTCCCGGTCGCGCTCAACGCTGAgaactgttgttgctgctgtcgtgcaCCAGCACTCGTCATGC
ATGCGGAACAAACCCGCAAGTGGGTAATCTCAAAAATCGGTTCTTCCAGTTCTCTTAGCAGTGCACACGACGAGCAcaccacttcaccacatgTTCGACA
GTGGTGTTTGCGTCGGAAGTAGAATCCACGCAAGCAAACTGCACACGCCTTACGGTCTGAGTTGGGCACCCACTGCCACTGCTCCACGAACCTCAAACTG
CTCACTCTTTGTCGTGCCACAAGTCCTGGGATCTTGGCCACTGCACACACCGTTTTCTTCATTAattcctccagcacgccCCTCACAATAGGGTTCAGAT
CTCCGTCAATCTGGCAGATTGAAGTCACCTTAAATGTGTTCGGCTGGTGCGTTTTCGAGACAATAATCCCCATTCTCGACAAATATCCTCTCGCGATCCC
GAAATTCTCCAAAGTCGGGACTTCTCGTTCTCTAGAAATAGATTCCTGGACACAGAACCCTACGACGCTCGAGCCTGGATGAGTTTTTTTCTTCCCCGCA
TACTCCAAAAAGCAAAAATCCAAGATTTTCtgatcttctccatgtcGTGGCCGCTGGGTCTTAAATGCGTGCCACTTAATGGCACGGTACGAATACGACG
CTCTTGAAGGAGCTCTATCTGTGGTATCACTGCCAGAACGAGCACTCTGTTGTGGGAAGGTGAATAGGGTGCGGCCGTCCACGAAGGCGTCTCCGTGCAT
GTAGCGCATGGCTTTCCTGAAATCTTTCGTCTTGACTTTCGCCACTGCGCGCAGAATTTCGTCCACTTTAGTGTCGGATAATTGCACGCTGGCTTTGAGT
AAAGTGGACGCGTGCGTGGACTTGTTGGCCGGCTGAAAGTCCAGGAAGTTGGCGCGTTGGCAGGACACGGACACGTCATCTTTGGCCTCCAAGCTGAGGC
GGGGGCGTCCAGGGAGTCGCGATCTGTGGCTGCGGTGCGGCGCGGTGTCGGCGCTCGTCCATTTGTACGCGCAGTCGGCGTCCTCGATGATCCGGATCAA
TTGGGTCACGCGTTCCTTGCCCAGTCGCTTATAGTACTTGACTTCCTCTCGACTGAGCGCTATCTGCGGGAAGAAGCCGTCGTGCAGGGGGAACTCGAGC
ATTATTCCGCAGCCCGCGCAATGCTGCAGTTTGGCAGCTGCGGCAACTTGAAGACTGAATGAGAGTGTGTGTGCGGTTGCGGAGAGCTGGTTAGGTGTTG
AGTTCGTTTTTCCCCAGTCGAGCAAGCCCCAAACCACCGCACTCTTGTAGGGTTTAGGACACGCAGGATCCGAGTACGTTTACGCCTCGGTGTATCTAGC
GACGCAGGAATCGGAGAGTGAACCGATCGTTGGCCGAGTGGCTCGTGGTGGCACGAGGGCCTATAGAAGGAAAAGAGGCGGCTTCTGGCAAAGAGCGCTG
TCGTGCAATTGTGGCAGCAATTGGTAAAAAAAGGGCGGCCGTTTTGCCTCCGAAGACGATGGGTACAGCCAAACGCGATGAAAGGCTGATGCGATGTCTG
CGACAAATGGAGTTTGCCTTTTTGCTGTTGACTCGAGGATAGAGCCAGCACCAAGCGCTTCATTGTCGTGCTgtcattgctgttcttgccGCCGGTCAGT
TTCCTGTTCGCTCTTGGTGTGGCGAGGGCGTTTCCAGAGAGGAAAATGCGCAGTCCGTCGACTCGTGGAGGGGTGTGGCACGCACGCGGACGATGGACGA
ATgacgactgcgactgcgactggaACGGAAAGATCCTGTCCGCCGGCGACTCTAGGCTTTAGAGGGCGCGGCGCTTGTGGCTgccgaaggaggaggtgtc
atgttgttgctgttgctggtcaACGCAATGCACCACGTAACGCAGCGGTTTCGGACTTCCGAGACAGCTTCCGGGCTGTGCGTTTTCGCTTTGGTGCTTG
GGTGAGCAGCGACATACACCTCCCCATTCGCCAGCTGTTTCGCAGTTGAAACGTATCCGATAAGCAAGCACGCAGCGCTGACTCAGCGCCACTGAcggcg
aaggcgaaggcaaCAAGCACGCTTTGCCCGCGAAGGGACACGACTGACTTGATTGAACTTTGTGAAATCTTAGTCTACGACTAACGATAAGGAACTTTAG
GCTTCCACGTGGCGCACGACAGTCTTGCTGAAATACCGGAGGCCGTGCACAAGGGTTCGTCAACGTAGCACTTTAGCTTAATGCATCAGTGTACTTACTT
CATAACGCTTAAAAATGCTCTTGCATGAACCATTGACCGTGACGGTGGCATTCGTCTTAGATCTGGACCGCGTCAACAATAGCCCCCGCTGATTTCAAGA
CACGTGTTCAGTTTGAACGAACTCTGTGAGTGGTCTCGGGAAGTTTGCGTCCACAGCGACATTGAAGGATATGATAGCGGCGGCGCCGGCAATCTTGCGT
TGTTGTCAACGACTATTATAACTAAGTCTCTATGCGCCACTGCGACGCCGCACTTGTGAGAGAACACACCTTGTCTGTGTGTATATAGTTGTAATGAAGG
CGATGGTATGCTCGGGTGGATGCTGGCGCAACGCTGTGTATGGAGATCCATACGAGGCGCCATAACAGCTCACAAACAAAGAAATCCTGTAACGTTAAAC
AACCTTCTATCCTATTCGATACTTTCAGTGTTCATGACTTTTGGAAGCCTCTTAATGACGCACGGCTGGATCCTAaacataccggtaccggtacatacTT
TTCATACACGTAAGGTCGATGGCCAGTTTAGTGCAAATATCTGATGCGTCTCAGAAGTTTTGCTGCAAACTTGGACGATAGAAAAACGAAGGGGCACCAA
TCAAAAGCTCACGAGCTCGGACTATCCTGTCGATTTTTTATAGCTTATGGCAGGACCTCTCAGACGGATGGATAGTTCCTGAACCAAATCGAGCCCCCGG
CCAGCTTAGTGCAGCCAAACATATAGGGAGTTGTAGCGGGGGCGCGCTGCCACGTTGCCTGCAAAACCGAAGATACACAGTATTTCTACCACTTATGTTA
CCGTAATCTAAATGCGTGATAATGATTGGACAAAACACATTTCCCTTTGAGAACGCATATgattgagcagcagcttgagctgtaAGAGCCATTCGTGCAG
TGGTCCGGCACCACTATTGCCAGCAGCCTCTTAATTTAGCGTCGGAGTGCGCAAGTGAAGGCCACTCTCGATGGTCGGGCGGGACAGGAAAACTTGGATA
AAGCTACACAACTTTTGGTTAGATTTTTTGCTGATTTTATTGGATTATTATTTCTCCAAAGATATTCCACAAACCAAAGTTCTCTATTATCGTTTTGGTT
TATTTGTTGATTGAATCTGCGCTACTGCAAATCTGCCGCCGAGTTGAAGACGAACACCGTGTCGAAGATAGAAactggaagctgcaggaaaATGATCGTA
ACACAATGATGGAATGAAGTTTCAGTCAAGTGTCAATTCGAGGCGCGAAGGCTGCGTCAGATGTAGGTAGGTTGCATCACTACTGCTTAGAACTTGTAGC
GGTGGATGGACTCGAGGTGGCGCACAGACCGCGGACTCTTAGGACGTGTGTCGTCCAAACGTCCAGATTTGCAGGCGTAGATCATCAGCACAAGgctcag
cagcgctttgAACGCTGCGAGGCACAGGAAAAATGCCACCGTGACCAGTATCCCGCTGGGCGACGTCAGCTCAATCGGGGCGTCCGTCAGAGCCTTTGAC
ACCATGCGCAGCACCACACACGCCAAAGGCAACGACATCAGACCCAACCGCTTGGACACGTGGTGCGTGTGGTCCAGAATCGTATCCTCGCTCTTCCAAC
CCGTCAGGTCGCGGCAAAGAATCGTGATGAACTTGGAGTACATCGTGGGCGGGATCTGGTTGAACTTGGTGATGAAGGCGTGCTTGATCCAGTCGATCAG
CATCTCAGCCACCCAAACCATTGCCTGCGGGGATACCACATCAGTTCAAACACAAGACAGTATGTATGAAGTGAGCAAAACACCGAGGTAAGAGGAAGAT
CATCAGAAACGTACTGTCCCCCAGGCAACAT