Description :
From Genome Similarity Track
Location :
Scaffold_677:368- 1495
Sequence
1127 bases(100 bases per row)
GTACGGTGAAGCTTCGGTAGTGCCAAAGGCACCACGCCCAGCCCCACGCTTGGTCGGAGGAGTACTGTTGAGTCGTTGGGGTGTTTGTGAGAGCGGAATC
ATGGACGGATCTTCATCTTGAACGATCGGTCGACTCACAGGCTGCTTTCCAGCGTTGATGCCCACAGCACCAAACGCCTTCCGACGCTTCTTCTTCCATT
TCTGGAGAGCAGCTCCGGCTTCATGTGGACTCCAATCTTGGAGCGACATCGTCGATGGGTATGTCTCATTCTCAAAGCCCAGCGACAACAGTAGCGAGCC
TAAATCCTCGGCATTTGGCTAGTCGACACCGAGTTGACTGCGTATTGAAGTTCCTGCGCAAGCGCAGGCCAGTCGGCCTTTCTCTTGGGGACGGGCTTGA
ACAGCTGCATCCACTCATCATTCTGCATCAGCGCTTGTACGCGGTCGAAAACGCGCTTGGCGGCTGGTGTATCACCGTTGATAGGTGAGCGAGGTGCCTT
CAGCAGTGCTGAATGCTTTGCACTCACCACCGAAGGTTTAGAACCCTCGGTCCCATCGTCATAACCATCATAGGCCGGTTCCGGTCCCGCAACATCATCG
CGCTCGTCGGCGAGGTTCCTCGAAAGGGACCTGGTCGCCCCGCTCAGCCCCCGATGATAGCTTGGCCGTCTCCGGCGTCGCTGCGCCTGGCTCTGGAGCC
GGCGTCTTGTCTTCGTAATCTTCATAATCGTGGGCGTCAGGACCGATGTCCGCTTCGTCGTCGAAGCTCACTGAAAGCTCGGTGGCGGCTGCAAAGCGCG
CATCCGGGCTTGAACTCTCGTTGCGAGCCCCGCCAGACTTGGCAGGCGTAACTGGTACCGTCGGTTGTCCTTTCGCCATGTTTCTTGTCTTTTTCTTGTT
CTTCTTCTCTTGGTAGCTCGTAAACTGGATGGCCATACAAACAGCTCACAATGGTCACAATCTGTTCCCGGGTCACGACACCAGTTGTGGTGCTGGAATT
CCCACGTGAACGCTAGCTACAAACGTAGTTAGGACGTTCCCACAACAATACGCTTACTAGGATAGTAAACGATCGTTCGGGCGGACCTGAAGACCCCAGT
TCTGGCCTTGCACCGGGACAAACTGGA