Description :
From Genome Similarity Track
Location :
Scaffold_75:368- 1467
Transcript NameFunction/comments
Phyag_g1626hypothetical protein

Sequence
1099 bases(100 bases per row)
cttcctgcagacACTACAGCAGCCCCAGTTGTGACCCGCGGGAAGTTCTACTACTGGCTGAAGCGAAATGGGTTTACAAGCGAAGAGCTGAAAAAGGTGA
AGGCGGCAACCAAGAACATGGAAATGCACGCCATCGCGCAAAAGGTGGCGGATGTACGCGCTGTGGAGGAGATtttcaagctgcagtcgatAGAGAAGCA
AAAGTCGGTGATCATCGTACTCCAGCATTCCAAGGAAACAATCGACAAACGACACCAAGAGGAGTTTGCAAACCTTCGAATTAGATATACAGCCGTGATT
TTCAGCTGGGGAGCACAGGACGCTTACAAACTCGGTGACACAATTGCCAAGAATGGTCGAATGTGTAATCGAGGTGAAGATGCTCGCGAGAAAGCTGACT
GGGAGCAACAAGTTGCGTTCAGAGTCAATCTGCGTGTCAACACAGTCTAGCGCTGCATCAATACAATCATGAGCGAAGGCCGCTACTCGCCTTCTGACGC
GAAAATGACGGATCTGAAGCGAACAGTGAACCGagcggagaaggaggagttggACTGGAGTATCTTTGTGGAGAAAAACAAAAACCACGACAACAAATTG
TTGGTCGAAAACCACACGGCGGCACCGTACATCAAGCAGTACATGATGCATGCAATTGTCACCGAATCGTACGCccatcgagcagcacgcatctgctgga
gctggatgcTTATGGTGACGCTGGTTCTTATTAAACTCGTCGTAGCGGTCGCCGAAGTGGTTGTCAGATTCGACATCGACGGAATTACAAATTTTGTGGA
CTTCATCGTTGGTGCCGTCACTCATGTTGCTGAGGCCCCTGACGCGATCCTGGGCATGCTTGAAAGTGGTAATCTGGCATCAGGAAGTGGTCTGTCGATG
CCAACAGGAAGCGGAGGCTCTGAAACTGGTGGTGATAGTGCGACGTCGATGATGAACACACTAAACGACAAATTTGGCAGTGGAGCCCGCCTCAAAAACA
AGAAAGCAAAGCTGCAAGCATTCATGAAACTCGAAAAGGTGAACGAACTCATCGACGAACAAAACCCCGCAGCCTCACTGCAACAGGCAAACTAGATAC