Description :
From Genome Similarity Track
Location :
contig_31:367998- 369503
Transcript NameFunction/comments
g7531.t1hypothetical protein

Sequence
1505 bases(100 bases per row)
CGTACCGCTGACAAGCCTGGGATCGCGTCAACCATTTTCGTGATCCCGCTTCGCCACAAAAACGTGTGGGAAATACTGTCTCGCGATGGGGCCAGAGCGG
AACATACCGCTCTGATGCACCATTAGTAGTCAAGCTCGTCGCTAGTGCTGCAAGCGGTGGGAACGACTAGGATACCGATGACCAAGAGCCCGACAAGCCC
AACGAGCCCAATGAACGCTCGGCTACTACGCCGTCGGTTTTCAAACCCGTGAATATCTTTGATGCCTACCTCCGACACCCGAGGCGGAGGAGAAGCTCGC
GCTGGTCAAGCGTGTGATCATGCATGGCGTCTTCTCGATGTCGACGTTGCGACCACTGGAGAGCGACAACTTTGCCTGGCCGTCGCTGGAGGCAGTCCGT
CTTCAGCAGCAGCATTGTCACACTGACGATCCGTGTTCTATGAACTCGGATGGTCTGTCCGTGTTGATGACAAGCTGTGGGTCCCTCAACAGGCGCGGAA
ACTGCTGCAATGACTTTAATCATGGTCCACTGTGGACTGCAAGGACATCGTGGCGGCGACGTTATGTGAGCGGCATTTGTCGAGCGGTTCGTTGTCATCA
ATCCGAAGCCATTGATTGCACGTTTCTTTCGTGACTGTCTACTATGTGAGTATGCCAAGATGGACAAGATTGTGGTGCAGCCATGGTGCCCAACACCTAG
AGTTACAAAGAGCAATGAGTGCCTTTACCTAGACTATTTGTACCGGAGTGAATCTTATGGTGAGACTAAGTACGTCTTAATGCTCAAGGACGAGCTCACT
CAGTACTACAAATTTGTCGCTGCAGACTCGGCGATCAGCACCACCGCTGACGAAGCCGTTTTGGACTGGCACAACCGTTTCGGATTGCCCGAAATGTGGG
TATCCGACAACGGGTCTCATTTCAAGGCAGATGTGATGGCCGACCGTGACTACCACGCCCAAGTTCGTGCCGATCTACACACCGTGAATCAATGACGCTG
TAGAGAGAGTTGACCGAGGCATTTTGCAAGTTCTACGCGTTTCGCTCCTTGAGCTTATCTTTGGTACCCGCAATGGGGCTTACTTACTACCGGTGGTCCA
AGCCAATCAGAATCATTCCGCGATGGCGTTCCTCAACAGACATGCTTCTATTGAGCTTTTCACTGGCCTGCCGTACTTGACAGTGTTATAATCTCCGTCG
GGGACTCTTTTCGCCCGCGCACTGTTGACATTGCCGCTGCGATGTCGTGGAAAACATGGAGGTGGACCTACCGACTTCATTGGCTTATTACGGTCACCTG
CTGATAACGGTCAGCTAATCACATCTCATTATTGGTTTTTCAGCTGCCTCTGACTTTAACGGTCAGTAGTATAAACAAATATATTATTACCTGGTTTACG
TACCATTCATTTGGCAACAACATGAGCTGCGCGCGGTGAACGGCGTGCGAGCGATCCGAAACGGAGAAGGGAAGATCAATACTTGTATTAATACATGTTT
GAGCC