Description :
From Genome Similarity Track
Location :
contig_31:367995- 369500
Transcript NameFunction/comments
g7188.t1RAW40823.1 hypothetical protein PC110_g2967 [Phytophthora cactorum

Sequence
1505 bases(100 bases per row)
CCCGTCCGTTAGTCGACAGTCCGGGCGTACCGCTGACAAGCCTGGGATCGCGTCAACCATTTTCGTGATCCCGCTTCGCCACAAAAACGTGTGGGAAATA
CTGTCTCGCGATGGGGCCAGAGCGGAACATACCGCTCTGATGCACCATTAGTAGTCAAGCTCGTCGCTAGTGCTGCAAGCGGTGGGAACGACTAGGATAC
CGATGACCAAGAGCCCGACAAGCCCAACGAGCCCAATGAACGCTCGGCTACTACGCCGTCGGTTTTCAAACCCGTGAATATCTTTGATGCCTACCTCCGA
CACCCGAGGCGGAGGAGAAGCTCGCGCTGGTCAAGCGTGTGATCATGCATGGCGTCTTCTCGATGTCGACGTTGCGACCACTGGAGAGCGACAACTTTGC
CTGGCCGTCGCTGGAGGCAGTCCGTCTTCAGCAGCAGCATTGTCACACTGACGATCCGTGTTCTATGAACTCGGATGGTCTGTCCGTGTTGATGACAAGC
TGTGGGTCCCTCAACAGGCGCGGAAACTGCTGCAATGACTTTAATCATGGTCCACTGTGGACTGCAAGGACATCGTGGCGGCGACGTTATGTGAGCGGCA
TTTGTCGAGCGGTTCGTTGTCATCAATCCGAAGCCATTGATTGCACGTTTCTTTCGTGACTGTCTACTATGTGAGTATGCCAAGATGGACAAGATTGTGG
TGCAGCCATGGTGCCCAACACCTAGAGTTACAAAGAGCAATGAGTGCCTTTACCTAGACTATTTGTACCGGAGTGAATCTTATGGTGAGACTAAGTACGT
CTTAATGCTCAAGGACGAGCTCACTCAGTACTACAAATTTGTCGCTGCAGACTCGGCGATCAGCACCACCGCTGACGAAGCCGTTTTGGACTGGCACAAC
CGTTTCGGATTGCCCGAAATGTGGGTATCCGACAACGGGTCTCATTTCAAGGCAGATGTGATGGCCGACCGTGACTACCACGCCCAAGTTCGTGCCGATC
TACACACCGTGAATCAATGACGCTGTAGAGAGAGTTGACCGAGGCATTTTGCAAGTTCTACGCGTTTCGCTCCTTGAGCTTATCTTTGGTACCCGCAATG
GGGCTTACTTACTACCGGTGGTCCAAGCCAATCAGAATCATTCCGCGATGGCGTTCCTCAACAGACATGCTTCTATTGAGCTTTTCACTGGCCTGCCGTA
CTTGACAGTGTTATAATCTCCGTCGGGGACTCTTTTCGCCCGCGCACTGTTGACATTGCCGCTGCGATGTCGTGGAAAACATGGAGGTGGACCTACCGAC
TTCATTGGCTTATTACGGTCACCTGCTGATAACGGTCAGCTAATCACATCTCATTATTGGTTTTTCAGCTGCCTCTGACTTTAACGGTCAGTAGTATAAA
CAAATATATTACCTGGTTTACGTACCATTCATTTGGCAACAACATGAGCTGCGCGCGGTGAACGGCGTGCGAGCGATCCGAAACGGAGAAGGGAAGATCA
ATACT