Description :
From Genome Similarity Track
Location :
Scaffold_24:36789- 39445
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_24-snap-gene-0.51Conserved gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_24-fgenesh-gene-0.12Conserved gene of unknown function

Sequence
2656 bases(100 bases per row)
GCCTGTACAGAGCAGCACGAGCCACAACCCCGTGCTGTGATAGAGCCGCAGCGACAGTAAATGCGTTCGCAGCTTGGCTTTCGACTGCTTCACGAGACTG
CCCTGTTGATTGGAGCACGGTTCGCATTGCGGATAGAAGCGAAACGTCACTTCTTGACGAAAGAGGCGTCGAAAAATGTTTTCGTTCATGCGCTTTGCCA
CACTACAGAAAGAAACGGAAGAGAGAGACATACAGGCAACGGTAGTCAGCACCAACCCGCATTCTCTTCTACTTGGACGACATGCACGTACAGTTTCGGC
GGCATATGATCGGCGTGGTACTTGACGCCCTGCTTGACGCCACATGTATGGCATCCATACAGCCGCCCAAATTCCTGGATAATGCCGCGTTCAATTGGGG
TCGCATAGTCAATTGATGCGGGGAGCGACGCCTTCTTCAAATGGAACGCGCCGAGGTTGGAAAAATTGCTCGGTGCAATCGCGTTCATGCGTCCGCCAAG
CATCTTGAAGCAGAGCAGGCCCATGATCATATACACGGGGTACGGCGCGTCACGGAACTCGTCTATCCGCGTCGTCACTTTCTGCCGCACCGTCGCTATC
ATTCCTTCATCCTCTGAGGTGATCGCGGGCCAGAAAAACGCAAAGGCTCCTTTGGCCTCGCCTCGGTTCTTTCTCAGCANNNNNNNNNNGACCTCGCGCG
GGAGTGACGCAAAGTGCAGCGCCACTGCAGACGACGCGGCAACTGCGACGACACCAACCGCTCNNNNNNNNNNNNNGGCTCCCACGCGCGCTGCTTTCTG
CAGCAGCTGCGCACCGGAGACGCCCATCCAGAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCCATGCGTCCATGCTCCCTT
CGCTTCTTATTGTTGTTGCTGTTGCATTTCACGTTTACAGATAATGTTTCCTTAATGTTGCTTTTCCGCACCACTGCCTCCTTAAGGAGCATCAGATGTT
GCTCGAACGTCGCGCTGCCGCACCATTACAGAAGTTGAAGTGCAATTGCAAGTCCCAAATGCAAGCTGCTATCATGAGCTATGAGCACATGGTGGATGCT
GCGCGTCTTGGAAGTGCTCTCCGTACTATTCGCTGGGGAGACGTCGCAGTCGCGTAGCTTTCTATCGTGTGCGATGCACGACCATCGAAGCGTGGAGCAG
GCATGTCGGAAGNNNNNNNNNNNNNNNNNNNNNNNNCGCTCCCAGCAAACGCGGTGGGATTTGAAAGCGGACAAGCTCACATCTATTCGAATCGCCTACG
TCGCTTGAGCACACGAAGACGATTGCGGCTGCACACGACGCCGTCGAAACACAAGTTGGCCACCGTGTGCTACGAGAGTCGGATCCCACACTGCCGGGAC
AACGCTAGATACGCTCCGACTTGACGTTTGGTTCGGACTCGAACGTACGGACTACTTGCCTCGCCACGTGCCTACGCTATAATAGCGCATCTCCAGACGT
TGGAGGTAGAAGGTGAGTATGCTCAAGTCTGGGGAGCTTATCGAACGCACAATTGAACTGAAAGACGCACGAGTGGTGGAGATTTCCAGGGATACAATGC
AAACTCTGTGTCAAGGTTGAAAAGAAACTGTGCAACTGCACGCACAAGCTTTATGATCATAGACCGATTCGAAGCCGATTTTGCGTGATCGACCCCACGG
TTTTCATTCAAGCGGACACAATAATCCAGCTCGACTCACGTTGCTTGCTGGGAATCTCACCAGGACAACCGCTACCGCCTGTTAACCAACCGTAGAGATC
GATCTCTTTACCGTGACTGCAATCAGCTGGTTCCTCCTTTCGGTTGGCCCGCGGCACCAGCAGTGGCAGCGCCGCCAGCTCAACGCCCTTAACATGAAAG
ACGACGCAGCATGTTGCAGCCATACAGTCATGGAATCGTCCAAGCTGTGCTGGCATGACTATTACGATATCGAAATGTGTCCGTTAGAACGTACGTGCAC
TGTTCTTTCCATGCTTCTCCTCGCTCACTACTTCTGGGTTTTCTCACACAGCCAACATTATCTGGTAATCGATCGTCTTTGCAAGATACTCGTCGGCCGA
CATGGACGTACTTCGGTTGCATCGTCCGAGTATTTCTTTTTTTTGAAGTCGGGCGCTATTTTGGGCAACGTGGCAATATCGCGGCATGCTCATTTCAATA
TGCCGAGACGCAAGGTGAACGCGCATGGCACTAACGGGAGGAAGATCGTCGATGACGTGTCCGCACATGGCGTGGAGGCGGACGAAGACATTCGCCGCGT
GTCGTTGGCGTCGCAGATCGAGGCCCTCGCGCAGCAGGGCGCCTTCGCCCAGGCCGTCAAGAACGACCGCNNNNNNNNNNNNNNNNNNNNNNNNGGCATG
CCGAGCGATTCTCACCAAGCCGCAGGGCAAGCGCACCCTCGACGACATCCACATGGTGCGCGAGCCTAAAACCAAAAAAGCAACGTGGAGGATAGTGCAG
ATGGTACTGCAGCGTGGACTCTCACGGTGTGTTTATTGTAGCTGAAATCGCTGTTG