Description :
From Genome Similarity Track
Location :
Scaffold_231:36783- 38487
Transcript NameFunction/comments
Phypl_g5674hypothetical protein

Sequence
1704 bases(100 bases per row)
TACTACAGTCCGCCGATGCAAACCATCTTGGTCTCCAAATATTCGTCCAGGCCTTCGGCCGAACCTTCGCGACCACTGCCAGATTCCTTGATACCGCCGA
AGGGCGCTCCAACGTGAGTCACCAACTCGCTGTTCACGCCGATCATGCCGCACTCCAACTCACCAGCAACTCGAAAGATACGGGCAAAGTCCAGAGTGTA
AAAGTACCCCGCGAGTCCAGCCGCCGTGTCGTTCGCCTTCTGAACCACTTCTTCCTCGCCCGAAAACACGAACAGCGGGACCACCGGACCGAAAATCTCT
TCATGCCAGACACGCATCGACTCATCCACGTCGGTCAAGACGGTTGGCTCGTAGAAGTTCTTGCCCAGGTTGCTGGGCTTCCCTCCGACGAGAACTTTGG
CGCCTTTTACCACTGCGTCTTCAACCAAAGTCATCACTTTCTTGACTGCAGAGGGTCCGATCAGCGGGCCGAGGTGCACATCAGGTTCAAGAGGTCTCCC
CATCTTGAGCGTCTTCACCCTCTCCACAACCCGAGCAGCGAACACTTCGTAGATACACGAATGAACGAAGATGCggttgctggcgatgcaCGCCTGGCCC
GTGTTGGTGAACTTGGTTCGGATCAGGCCATCGAGCGCTTTCTCGAGATCTGCGTCTCCAAAGACGATGAACGGGGCGTTGCCGCccagctcgagcgaca
gACTCTTCACCGTTTCGGAGGAATGGCGCATCAGCCACTTGCCAACTTGGGTCGAGCCCGCGAGCGTGAGTTTCTTTACGTCGGAGCTCGACGTGAGCAC
ACGACCAACTTCTTCCGATCTCTCTCGTGGAGCCGTGACCACATTGATAATTCCTGGTGGGAACCCCACTTCCTCCGCGAGTTTGGCCAACGCTAGCATA
GACAGCGGCGTCTCCCCTGCGGGCTTGATCACAGTGgtgcatccagcagcgagggGTGGCCCCAGACTCAGCCCTAAAATCGCAAAGGGAAAGTTCCAAG
GTGAAATGATACCGCACACCCCCACGGGCTCCTTCATGACAAGGATCTTCTGGCTCGGTTGGGTCGGCGATATCAAGAACCCACTGGAGCGCACGATCTC
GTGGGCGAAATACTCGATCACTCCGACTGCGAACTCAATTTCCCATTTGGCCTCTGGCAGGGGCTTGCCGCATTCCACGGAACCAATAATTGCCAGGTCT
TCGGCATTGGCGGTGATAGCAGCAGCCCATTgtttcagcagcttcgctCGGACCTACGCATCAACACAGATGACAACAAAAACATGACAAACGTTCATTA
GACTCCTGGCACGCCTCACTCAATGCATTTCGAGCGTTATCTTGCCGGTGGCGTAGTTTTCTTCCACTGACGTTGAGCAGccgttgcagcagcgatggca
tTACGAGTGTCTTCACCTCCCATGCTCGCCACGCGGGCGATTTCTTGCTCCGTTGCAGGGtctgctcaagaagaacaactGAGAATCCGGACCAGCTTTA
CGGGGGGAAATAACATTCAAGATGGAAGCTTACCAATGACGGTGAAGTGATCGTTCCCGTGGGCCTCGACCCATTTACCGTTAATGAATCCTTGCGCACC
CACGAGATCgggtcgctgcagcttcgacaggAGCGGCTGGTACTGCCGCTGTTCGATCGGGGCCAAACCTAGAGAGAGCTGGGCGGGCGGAacgctggtg
gacg