Description :
From Genome Similarity Track
Location :
Scaffold_1224:3678- 4750
Sequence
1072 bases(100 bases per row)
TCCCAGGCAAGGTAACCTCAAACTCGCTCTCCAAGCAAATGCATGGCATTCCAGGAATTCGGAGCAAAGGAAACTGCCGTAGCCGAGTTGTCAAAAGTCT
CTGAAGGCACGAGTTGCGTATCGTTCTCAACGATTGAGACGAAACCATTCAACCATTTTCAGGTGGCTGGTCCCTGCCGCTTCATCAATAGTTCTCGATG
AGTACCCCTCGTTTCGATTCACGTGCAATCCCTTGACTACTTCAAGATGGCCCATAGTGGCGGAGTCATCCATCGCTTGTTCTGTACAGCTGCGTCAAGA
TGGCCATTCCTTGCTGCCCAatccatcgctgcagcagtacatCCTCCGTCGCGGTTTTCAATGAAAACTTTTCATGAAGCCATTGCATCATGTGCAAATC
ACCCCGTTCTGCGACCGTATCAATCGCTTCTGCAAGATCGAAGTATTCCTGTCGGTTTCATGCAACCACTGCACCATGTCAAGGTTACCTCTACCCGCAG
TCATTACCATTGTTGACAACTGACAGCCCTCGCTTCGCTCAATTGGAGTTATGTCGCAGTCTTGAGAAATcttgatccagcagcagcatccaacgCAGAG
CGGGAAGCGGATGTATGCAAGTCGTTCTCGTATAAATACTTCAACACGTCTAGCTGACCATTCCCAGCGGCAAGGTAGAGcccagcttcagcatcctTGA
CCTCCTTCTCTACGTGAAGCCACTTGAAGAACGTACTCAAGGTTCGGTAGTAGGTAGCTCCAGCTTGGATAACAGCTTGAGCAAGTCCAGGTTTCCGTGC
GTCGCGGGACCCAAGTAAACATTGGAATAAATACGAGTGGTTTCCAGATCAGCGCGATCGCTATTGTCCAGAATGAAATGGACAATCTCCCACCGACAAT
TCGAAGCTGCGTTATCCAACAGACCAGCAATTTCAACATCGAAATTCCCGAACAGCCGACTCCACGATCCTCAAGTTCCCTGATGCTGATGCTCGAGAAA
CAACTTCCTGGGCACATTCGGGTCGAACCAGACAGAGACTGCCTTCGAAGTTCTTGTACTCCTCAGACAAAC