Description :
From Genome Similarity Track
Location :
Scaffold_205:36771- 38382
Transcript NameFunction/comments
Phyta_totarag5565hypothetical protein

Sequence
1611 bases(100 bases per row)
GCCGAGTACTACAAACAAGTTCGTCTCGCTCAGCTGGAAGTTGAGTGCGAATTGGAAGAAAACCTGCACATTCGAGCAGCTCGGGAAGCGAAAAAGCTTC
AAGCCATCGAGCAACAAGACAGGCAAACTGAATTAATGATTAGCAGTGCGAGGTCTCCTCAAGACAGTTTCAACGTTGCTCTGGGGAACAGTGATTCGAC
TAAGTTGCTGAGTGCAGAGTATGTGAAGGAGGGCGAACCAAGTAGTGATCACGAAGACTTGACACGACTTGATGCTGCCCCTGGCAAACCTGAGCTGGAG
CAAATATCTCCTCAGCAAACACACGGAAATGAAGAAAATTGTGCCGACACGAGTGCGCAGGACATTGTTATCAGCTCACAGCATAATGAGAGTGACGCGA
GGGAGGACGAAAGCACCAATCGAACGGAATCCGTCGAACAGGGTGCGTCGAAGGAACCAGAGCCAAAGCTAACGACGAACACTGAAGAAATCAATACCTA
TGTCGATCCAGAAGATGGAGGTCGCCAAGAAGTAGAAGCTAATGGGCAGATACACTCAAAGCAGAAGATGTatgatgacgacgaattTGATGCTAGTGGT
GACGATACAACTGACAACTGCAAGGCAACAGGTTCTGTCAATGTTGAACAAGGTGTTTGGAACGTGGATCCAAACCCGCAGAATAatcaccagcacgacg
aggtggagagtAATTGCCTCGAGCTCGATCAACCGGCCGACCCAACTAACAATGGAAACACAAATCCTGTAGTCTGGAATGTTGATCCCAATCCGTCAGA
CGCTGAGACAGATTTCCACAGTGGAAGCGGTACGGAGAGGGTGGTTTGGAATGCAGATCCTCATGCAGCTGGCTCAGATGCATCGATGGACGACGCGTCG
GTTGTCAATAGTGATAATGACGACGATGTACATgatgctgcactgcagctggaagaTTCGGTGCCGAGTGAGGACAACCATGCGAGCAATGTCTGGAATT
TAGATCCGAACTCTTCCGTTCCCACAGAAGGAAAGCTCGCAAATGCAACTTcagtacaagaagaagaatcaGCTATTCTTGATGAGATTGGAGAGAGAAA
GGTTTGGAATCTAGATCCAACGTCATCGCCAGACCCAGTTCAGGCAACTACAAACATTACAGAGGCACCTGACAGCCGTCACCTCGCCGAAATGGAACAA
CCAGTTTGGAACTTAGATCCTGAGCCTGTACCTGACGTAGCCACGAGTCCGGACCTACTGCCTGCACTAAGCAATGCAGAGTTTCAAACAGAAGTTGTTG
CAGGCACCCCTGAAGAAAGAAACGCCGGTGCCGAAGCGAGCAACACGGTTGATCCAAACGCGCCGGATGCTATCTCTGATACTGACTCAACAACAGACAA
AGACAATGGACAACGCACTTGGAATTTGGACCCGAATCCGACACTTTCTTCGCCATCTCCTACACAAGCTAACCACTCCGAGAGTGCTGACGATAACAAG
CCAACGCAAAACGCAGATCCACATGTACCAGAGGGAGTAGGTGCTGGCGCGTTGTCTGTCGATGCTGCAAAACTGCAGACCGAGTCAGATCACGAAACTA
CCGATAACGAA