Description :
From Genome Similarity Track
Location :
contig_25:367583- 368922
Transcript NameFunction/comments
g6153.t1hypothetical protein

Sequence
1339 bases(100 bases per row)
ACGCGTGCTGCACACGAAATGGGTATTCAAGGCCAAACTCGATGAGGGAGGACTCCTCGAGCGCCTGAAAGCGAGACTCGTTGCCCACGGGAATGATCAG
GAGTTCGGTGTTAACTACAGCATTACCTTCGCTGCGGTCGTCGACATGACCAGCGTCATACTGATTTTGGTGCTAATGGGGGGAGGGGTTCCTGCAAAGC
AAGGGGGCGTACCGAACGCGTACGTCAAGGCCGAGAAGGAGGCAAATCTTGCCATCTTCATCCACCTCTTGCAAGGAATGGTGATCTCGGAGGAGATGCG
AAAGGCACTGGGAGTCGAAAGAGACGACGAGATCGCGCAGGAGCTGGAGAAGGCCTTGTACGGCCTGAAGCAGGCCGGGCGCCTGTGGAATAAGTTGTTA
CACAAGAAGCTGGTGACGATCGGGTTCGTGCAGTGCCTGACCGACATATTCGTGTACATCAGATGGAGTGAGGTGGTGCTGTTGGTGGTCGGCGTCTACG
TGGACGACCTGCTCGTCACGGGCACGGAGCAACTACCAGTGGACGCCATTTTCGAGGAGCTCAGAGAGTTCTCGGTCAAGGACTTGGGACGAGCGATCAA
GTTCCTGGGGATGTGCGTCAATTACGATGAAGTGGACGGATACGAGCTGGACCAAGAGGTTACGATCATGGAGATAGTGAGGGATTTCGGCATGGAGCTA
GCACACGGCGTGCGGGCTCCCATCGGGCCGGAATGGAATGAAGCTCGAGATGCTGAAGGTGAGAAGTTGCCTGTCGCTGGAAGTGACGATGTTGTCACCG
CGAAGAAGTTTCAGTTACTGGTCGGGAGTATAATGTGGATCGCGCGTTGCACGCGGCCCGACATCGCGTTCGCCGTGCACAAGACGTCGCGGCGCACGCA
CAACCCCACCATGAATGACTGGAAGCTAGCGAAAGGGTTTTGCAGTACCTCGGAGGAACGAAAGAGCTGCGGCTCCAAATGCGAGGTGACCAAAAGGCAG
ATGAACTGCTGAAAGTTGCTGGGTAGAGCGACGCGGATTTCGCTGCGAACAGAGAGGACCGGAAGTCCGTCACGGGCGGGCTGGTGACAGTGGACGGAAG
GCTCATTAGCTGGATGTGCAAAAAGCAAGGCGGTGTGTCGCTATCGACAATAGAAGCTGAATACTCGGTGGCCTCGGTAATGGCCACGGAACTTCTCGGT
GTGCGAGAGCTACTCGGTGAGCTGGGTGTCAAGCACGAACAACCCATGCTGCTGCACGTCGACAACCAGGCTGCGCTCAAGTAGTTGAACGGCGAGGGTC
CGGGAAGGCAAAGCACATCGATGTGCGGATCAAGTTTGT