Description :
From Genome Similarity Track
Location :
contig_31:367532- 369037
Transcript NameFunction/comments
g6111.t1hypothetical protein

Sequence
1505 bases(100 bases per row)
GTAACCCGTCCAGCCGTCAGGTACACAAAGTGACTACAATGGTTGCGATCGCGCCAGATCAACGGAGTACCCCGTCCGTTAGTCGACAGTCCGGGCGTAC
CGCTGACAAGCCTGGGATCGCGTCAACCATTTTCGTGATCCCGCTTCGCCACAAAAACGTGTGGGAAATACTGTCTCGCGATGGGGCCAGAGCGGAACAT
ACCGCTCTGATGCACCATTAGTAGTCAAGCTCGTCGCTAGTGCTGCAAGCGGTGGGAACGACTAGGATACCGATGACCAAGAGCCCGACAAGCCCAACGA
GCCCAATGAACGCTCGGCTACTACGCCGTCGGTTTTCAAACCCGTGAATATCTTTGATGCCTACCTCCGACACCCGAGGCGGAGGAGAAGCTCGCGCTGG
TCAAGCGTGTGATCATGCATGGCGTCTTCTCGATGTCGACGTTGCGACCACTGGAGAGCGACAACTTTGCCTGGCCGTCGCTGGAGGCAGTCCGTCTTCA
GCAGCAGCATTGTCACACTGACGATCCGTGTTCTATGAACTCGGATGGTCTGTCCGTGTTGATGACAAGCTGTGGGTCCCTCAACAGGCGCGGAAACTGC
TGCAATGACTTTAATCATGGTCCACTGTGGACTGCAAGGACATCGTGGCGGCGACGTTATGTGAGCGGCATTTGTCGAGCGGTTCGTTGTCATCAATCCG
AAGCCATTGATTGCACGTTTCTTTCGTGACTGTCTACTATGTGAGTATGCCAAGATGGACAAGATTGTGGTGCAGCCATGGTGCCCAACACCTAGAGTTA
CAAAGAGCAATGAGTGCCTTTACCTAGACTATTTGTACCGGAGTGAATCTTATGGTGAGACTAAGTACGTCTTAATGCTCAAGGACGAGCTCACTCAGTA
CTACAAATTTGTCGCTGCAGACTCGGCGATCAGCACCACCGCTGACGAAGCCGTTTTGGACTGGCACAACCGTTTCGGATTGCCCGAAATGTGGGTATCC
GACAACGGGTCTCATTTCAAGGCAGATGTGATGGCCGACCGTGACTACCACGCCCAAGTTCGTGCCGATCTACACACCGTGAATCAATGACGCTGTAGAG
AGAGTTGACCGAGGCATTTTGCAAGTTCTACGCGTTTCGCTCCTTGAGCTTATCTTTGGTACCCGCAATGGGGCTTACTTACTACCGGTGGTCCAAGCCA
ATCAGAATCATTCCGCGATGGCGTTCCTCAACAGACATGCTTCTATTGAGCTTTTCACTGGCCTGCCGTACTTGACAGTGTTATAATCTCCGTCGGGGAC
TCTTTTCGCCCGCGCACTGTTGACATTGCCGCTGCGATGTCGTGGAAAACATGGAGGTGGACCTACCGACTTCATTGGCTTATTACGGTCACCTGCTGAT
AACGGTCAGCTAATCACATCTCATTATTGGTTTTTCAGCTGCCTCTGACTTTAACGGTCAGTAGTATAAACAAATATACCTGGTTTACGTACCATTCATT
TGGCA