Description :
From Genome Similarity Track
Location :
Scaffold_17:367499- 368609
Sequence
1110 bases(100 bases per row)
ACGGTTATTTGGGCTACACATGCATGCCAGTGGGATTCTGTCCGTGGAAATGAACAGTTTTGTGGCTGGTCCCGGCACTATCCACGGAGCTCATTAGCCA
ACTTCAAGATGATCATCAGCAAGTGAAGGAGGAGGCCATTGCACCAAGGCGCAGAGACAGAAGGCACTCAATCATCCCCTCAGACCGCACAAACCTCTTT
CGTGTGGTTGAGGTCGAGGAGGATCTGAATTTCTCCGGTGTCGAGAGAGCGCTCGTCGCCCCGTCAAGATCTGCTTCGCTGCTCATTGATCGTCCTGTTT
GCAAGTGGCGGTGTCCAGGCAAAATACTAGGTGGTACAGTATACCACGGGGCTGTACGAGTTGAGAGAGAGTGATGTTTCGGTGCCATCTCATTTAGTCC
CTCGGTTGGTTAATTTGTTGGTTATTACAACAGAGGTGGAGTAAACAGAATTGAACCTCCCCCTTAAGTGATTGGCGACGCTCTGTAATGGATCCAACTC
CAATTACATAAGTAGGTATATTTCTTTAATTATTACATAAGTAGGCAAAGTGGCACACGGGTAGCGTGTGTCAAGGTGTAGCCATCTGATTGGTTGATAG
TGAGGAGCCAGAATCATTTATTGACCAATCAGGTGTAGGCATGTGTTTGAGTGGTTCACACGAGGCCAGGGGTAGCCGCCCTGGTCCTAAATAAATCAGA
GTTGAATTTGACACAAACCTAAGACTTGGTTTTACTATTGCGAGCTTCCTCCACACTATAGTGTAAGCTAGTGACGGTAACGCTTACCCCGTTACACCTG
GTAGCACTTTGTAGTCCTTCCAACGACCAAGTCTACGATGAGGTAAGTCCAGATCTCCGGGGCGACCCTGGAGCATGCTGCATTCCCCCATCTCACTTGC
GTGGAGTGGGAAGCGCTTCACCGCCTCGTGGCGGTGTCAGGAGATGCCGTTGTCGCATCGCTGCTGAGCTCAGCGACGCCCGACCAGCAACGTATTGCAG
CGCAAGAGTTCATGGAACGCGAGCTCGCCGATGCGAATCGGCGGGTGTCAACTCCCTCGCGTCCATCCCAGAATGACGTCGTCAAGTTGGGAGACGTCTA
CCTATCCTGG