Description :
From Genome Similarity Track
Location :
Scaffold_25:3674- 5501
Transcript NameFunction/comments
Aphas_H257_09603AlNc14C579G12208

Sequence
1827 bases(100 bases per row)
GACGTCATCGCGATAGGTTGGTGATTTGGGGTCTAATACGAAGCCATGCTCGAGGAACAGCTTCATGAACGCAACGAGTAGCTTTGAATTTGACTTCTTC
TGTTTCTCATTTTTTGATTCCCACAGGCGAGGCTGCAGTGCGTACCACTCAAACCACGTCGCATTGGGATGCGTTGTACTGGATTTCTTTCGTTGGGGGA
CGGTCGGCATTAGCTGATGTTCGTGGCTCCTTGGGTTCGGCAGCTCGGTTGTTGGCTTGGATGGCTGCGGCTGACACGATGAGTTGAGGTGTGCTTCAAG
TACGTCCATTCGAGCGTTTTGGAGCCTTGCGTTCTCGATGAAATGTTCAATGACCATGGCTTGGTGCTAAATACGTTTGTCTTGATCTTGACTTGTAACA
CTTGCAATCGTGTGATATGTACAGATGCATACGCCACAGTCAGTGCTCCCTGGACTTCAACAAGGTGCGACGACCAAGCAAGCACGTCAACAAGGGCGCA
CCCAGCCTCGACAACGCACGTCTCCAAGCGCTAGACTGCCAAAGGTGTTTCGGGATTTTGGGACCGATTTGCTTCAACATCGGGTAGTGTAGTATGATGT
AAGCCATAAGGAAACTCAGCACTGACTTACTCACGTTGTACATTGCTGTACCGAGGCCATTGCAAGCACGGCGTCGATTTGCTCTTTCGTGCGGACATCA
AACGTTGATAGGCTCGCAAGTTTGACGGTGTCTGTTGGCGCCCAGCCGCTCAAGGTCTTTGCGACTTTATGATCTTCTAGCGACGTGTTGAACACATAGT
TAAACGCCTTGTTCGTAGCACTGACAGTACAAAGGCCGCGATCGAATATCCACGGAGAAGAAAGGTGTTCAACAGCGTTCTCATGCTGCGAGTCGCCACG
ACGGACTGAGTGGGAGGTAAGCTGCTTGTCTACACCAGCCAACTTGATGATGCGATCCAATACACGGTTTTACGTGGCAGTGAATCGTAGAGCTTGGCGC
AGCCTTGGTGTCGATGGCGCTTGATTGCACAGTGGCACCAGGGTTGTCCAGAAGATCGATGAGCGGTGCGTCTAGACCGAGGGTCACAGGTGACATCTTT
GTTTGTTGCGGCAGGTTGTCGACGAGGTCGGGGGATGGGGCGAACATGAGACATTAGCAATAGCCCGATTGCAAGGGGTGGGCAGGATTGGAACTCGTTG
TCGGGAAATAGCGATATCCCCAGCTCTTCCCTTGTCTTCATGCGGATAAACTTCATAAAGAAAACACCACCACCATCAATCGTAATGTTTTGCTTCCGCA
CGACGCAGAGATCGGAGGCACGCCCAAATAAGTACCACAACAGGTTGATCAGTGCCGCGTCTTGATAGTCGCTGCTTGTACGAGCTGTCGAGTACAAGTG
CGTCGTCATCTGCTTTAAATGGAGCTTGGTACATGCAATTGCTTGATTCACAATACCGCCACCGTCTCGCTTCACGCAATAGTTATCCAAAATCCGGCCA
AGCTTGAGAAGGCGCGTTTCGATCAGAACTTTGTGCTGTGGGAATTGGTCGAGGAGCCAGTGCTTAACTTGCCTATAGTATTGCATACATTAATGTCTAG
CTAGTTTCTCACCAGACTCGCCTTCATTAAATGCAAGATACATGCCAAATTGTCCATGACAGACACAAAGTTATGTCCTGTCGAATCGTTGGTGATACAC
GATTTCATGTAGGATAGTTCAACGCTTTCAGACAAAAGGAATCTTTCGAATGCCTTCACGGCGGTTGCTCGGGCTCTCTTAGAGTTTCCTGGCAAAAGAT
CATATAGCCCCATACACTGGTCGGAGA