Description :
From Genome Similarity Track
Location :
Scaffold_415:3673- 4697
Transcript NameFunction/comments
Phymu_g9668hypothetical protein PHYSODRAFT_256277

Sequence
1024 bases(100 bases per row)
GTAGACGGCCCGTTCTTTTCTTGAGCTGCCAGTGCTTCCCGTAGCTCTTTGATCTTGTCCTGATACTCCCGAATCTTCGCGTCCTTCGGGTCTTCGTTGA
TCTTGGGTTTGTTcttgatgttcttggcgCGGTTCGCATAGCGCAAAGTGGATAACGTTTCGTTGTAGTTGTAGTCCGCCGGTCCACAGTTGGCGATCAT
CACAGTCTTCGCATTGCCACCAAGCGAGTCCTGAAGTAAACGCGTGAGCTTGGAGTCGCGATACGGAATGTGCTGGGATTTGCCGTCCACGAGCGCCGAG
ATGACGTTACCCAGAGCCGAAAGACTCAAGTTGATCTTTGTCGCTTCTTTCATGCGGTCCCCCGTGGCGCCGGTCTTGGCCTGCCGCTCGCTCCCTGCCA
GATCGACGAGGTTGAGTTTCCCCACACAAATGTGAGGCTTGCTATTGGCGTCGGTTTGTGCCGTCGAGCACGCTTCGACCGTAATGGTGAACATGGAGTG
CGACCGAGAAGACGTCTGGTTCATCAAAGTGGCTCCGACGctgcggttcttcttgccctgCTGCATCACGGCGTCGATCTCGGCCGCGGCTGCGACTTGG
CGGGACGTCAGATCCTTCACGAACACGCCCgcgtccaccgtctccttcaACTCGAGGCGGTTCTTGGGATCTGGAGCGAGCAGGTCGCGGATCTCTTCGT
TGTAGATCTCCAAGTACGACGCGTACACCATGAACTGTTTGTTATCAGATTCCGCAGCGATACGGTCGAAGATATGCGAGAAGGAGTTCGGGATGATCCC
TTTAGCCTCGGGCGGTTCCGAATAGCCCTCCATCGTGTGCGACTTACCGGCACCCGTTTGACCGTACGCGAAGATCGTGCCGTTAAAGCCGTTCACGACC
GACTCGACGATGTCGGTAGCTGCCTGCGCGTACACATCTTGCTGCGAGCTCTCGGGCGGGATGGCCGCGTCGAACGTGAACTTCTTGGGCGGCTCTCGGG
CGTCGGCTTCCGGGTTGGAGAGGG