Description :
From Genome Similarity Track
Location :
Scaffold_10:367292- 369030
Sequence
1738 bases(100 bases per row)
TGCAAGAGGAGTTCGTGCGAGGGTTGTGGATCGACCGAATTCGTCGAGCTCAAGATGAAGAAACGTGGATCGCGGGTATGAAGAAGTACCTGATGGGAGA
TGTGGCTGAACTGACGCAGGATGAGGCTCGATCCTATGGCAACATCGCAGCGGATTATGAGATCGACGGTGATAATCTGCTGTTCTATTGCCCGCCCTCC
AAACGATCGGAGGCAGATCGAGATGGACTGACGAGGCTGGTTGCACCAGAGACGCTCCATCAAGATATATCACTCCACTCTGGAAGGTGGACACCAGGGG
ATCGGGCGTACCTATCAGCGGATCCGCGATCACTTTCATTGGACAGGTCTCTTCAGGAGTGTGCAAAAGTACGTCGGTGAATGTGTCGACTGCGAGACCG
GCAAAGGACGACCCACGATCAGGAGCGAGTCGCCGGGGAATATCCAGACGACATACCCGTTCCAGATCATAGCAATGGATCACATACCTTCGCTACCCAA
GTCGTACAAGGGTAATACGGAAGTGTTGATTTGGGTCGATCTGTTCACGGGATACGTGATCGCGAAGGCCAGTTCGTCCCGAACGGCGCAGACGATCGCC
GAGTCTTACGAAGAGTGCGTGTTCAGGCGATTTGGTGCTAGCGAGGTGATCAGACATGATCGCGAACCGGGATTTATGGCCGACTTCTTCCGCGCCTTTA
ACAAGATCCTGGGTACGCGTCAGCGAGCGACGATGACATATCGACCTCAAGCTAACGGTACTGCAGAGCGAATGGTACAGACGGCGACGAGAGCCCTGAA
GATGTTCGTGGAGGATCTGGATCAGAGAGATTGGGATGAGTACGCAGAGCGATTGACCTTCGCGATCAACACGGCTCAAGATCGACTCCGACGAGACTCC
CCTTTTTATCTGGTGCATGGTTGGGATCCTCGATCGACGCTCGAGGCGACGATACCTTTGGGTAGTACTCGGACTCGGGATCGGAATCCTCGACGGTGGC
GTTTTCGGATCCAGAGGCACTATGATCAGGCTCGAAGTCAGGTGATTGCTCGCCTACGCGAGGCGATCGCGGATCGGGCCGATCGACACAATGAAGAAGT
TCGACCACACGCGATCGCTAGATCTCAGGTGTGGCTGTACCTGGATCGTGTGAAAGAAGGGTATGCCCGGAAGCTGGCTCACCCGTGGCACGGCCCGTTC
CGGGTTGCGGAGAAGGTGAACGAGTACACGATGAAGCTTCAGATCGCTGGTACGGACTATCTCCTGTTCCCGATCGTGCATGTTTCGAAGCTGAAGTTGG
TCAGGGACTTCCCTGATCGACCGCAGATCGCGCTCACGGTGGACGAAGCAGATCGACTTGATTTCGACGAAGTCTTACTTCCGGAGGACAGCTGGGCCCC
AGATCGAGACTCGAACGAGTACGAAGTGGAGAAGATCACGGATATGCGGACGGGTCGAAGGACGCGGTACGGCCGGATTTATCGAGAATTCCTGGTACAC
TGGAAGGGTTACGACGAGCCTGATTAGGTCGACGAAGCTGATCTCAACTGTGGAGCTTTATTACACGAGTTCCTTCGAGATCGCGTGAGCCGGAACCGAT
TTGGCGCGATGCAGTCTCACGAGGAGGAGTGAGCTCGGATCGCCAGGGTGAGCTGGTCACCTTGGTGAGCGAGAAGGATGACGGATCGACGGGGAGGCCG
TTGATCGGAGGAAGAGGTTGTATATGAATGAATGCGTG