Description :
From Genome Similarity Track
Location :
Scaffold_748:3672- 7967
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_748-snap-gene-0.4Protein phosphatase 2C
Pytar_ATCC12531maker-par_contig_748-snap-gene-0.93'5'-cyclic nucleotide phosphodiesterase

Sequence
4295 bases(100 bases per row)
GTTGCGCTCGACGCTCGTGCTCGGCGGGCTCGGGCTCTCGATGCTCGCGTTCGCGCAGGCCGAGTTCTGCGCCGTGAACGCCGCCGGCGACGCGCAATGC
GACGCGCGGTTCTCGCCAGCGTACAGCGGCGAAGACGTCGGCGATGCGATCGGCTTTACGGTGCCGCTCGATGGCGAGAAATTCGAGCAGTTTGACGGCA
CCGCGCGCCGCGCCAAGCGCGTGAGCTGCGCGTCGTACAAGGCGAATTTCCCCATTGAGGACAAGTTTGACGTCCATGCGTCCGCCGACGGCGGCGTCTA
CGCGCTCGTGCTCGACGGCCACGGTAAGTTATCGGTTATTTATTTCTCTTTTTCTTTCTTTTCTCTCTCGGGAATTAACAACACTTTTTTCGCGTGTTGA
CAAGGTGGATGGCAAGTATCCGAGTATGGGCGCAAGGTGTTAATTGGCAATGTGGAAAGGGAAGTCGAGCAGCTCCACGCGTTCAAAGCCTCGAAAAAGA
ATCCGCAGGACGGCTCCTCGCCCAAGGTGACGAAGCACCACATCGCCAGTGCGATCCAGCGCGGCTTTGGGCGCACCGACCGGGACCTCCTGGCGCAGGT
CACGTCGGCCTTCCAGTTGGGCTTTGGCGCCGTCGGCCGCTGCGGCTCGTGCGCGCTGCTCGTGCTCGTCAAGGGCGACGTGCTCCACGTCGCGAATGCT
GGCGACATTCGCGCGGTGCTGGGCAAGAAAACGGGGGCCGACAAGTGGGTCGCCGTCGCGCTCACGCAGGACCAGAACGCCATGTCCAAGGCCGAGCAGG
AAAAGCTCACGCGCGAGCACCCGGGCGAAGAGAACGTCTTTGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGC
CCCGACTCGTGCTACGTCAAGGGCGCGCTCCAGCCGACGCGGGCGTTTGGCGACTTTGCGCTCAAGTACTCGGAGTTTAACGGCCCGGCCTACGTCAACG
GCGATCNNNNNNNNNNNNNATTGCGGCGCCGTACTCGCCGCCGTACATCACGGCGATCCCCGAGGTCAAGTCCCACGAGATCAAAGCTGACGATGAGTTT
GTCATCATTGGCTCGGACGGCGTCTGGGATTTCCTCACGAATGAAGAAGCCGTGGACGCGGTCAAGGAGGCACTGGCCGCGGGCACGCCTGAGCGCGCTG
GCCGCATGGTCGTCGAGAAGACGCTCCAGAAGGCGGCTGCGCGGTACGGCATGACGTACTCGGAGTTGCTCAGTCTGCCGCCAGGAGGCCATCGCCGTCG
CCGCCACGACGACACAACGGTTGTCATTGTCTTTCTCAAGTGATCCCAGGTAGAAAACTATCCTTCCGACTGGTAATGATGGTGCTGCATGAAAACCCCT
TGTTGTCTCGTCTACCGATGTCTAGCTGTCGCCATGGCAGGCGAGTTCGCGTGGGGACTTCCCTGCGGTGACAAGCCTGCGGCGGCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
ACTGCATGAAGTCGCCGCACCGTCGCTTGCTGTCTTTTCCGCTCGTCGACACTCTTCCAGCTGCGTCTGGAAGATCTCAAAGTTTCTCTCCAGCTCATCG
GCGTAAAACTACAGACACCATCAGTCTCCATGTACTCCATATCCAAAGCCGGCGAGAGAGAGACGCACCCGAAGCTGGTGGCACAGCGAGCTGAGCGGCA
ACCAAATGGGTCGCGCGACGTAGTTGATGAGGTTGAGCTGCACGACGAGCCGGTGCTTGCGGCTCTCGAGATGCTGCATGAACACATCAGTGGCGACCCC
GAGGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAACTCGTCGAGCAGGCGCGCGCCCCAGTCGGACGCCTGCCGAAACGGCAGTGCCTGG
TGAGACAGGTCCGCAGCATGCATCAAAATGCCCATAAGCAGCTGCTTCTTCTCGCTCAACTGGCGCCGCGTGAGGCTCTCGAGCGCCTTGCACTTGTCAA
AGTGCTTGGCCATGTCGGTCGCCAGGATGCAGCTAATGATCATCTGGCGCACGCGCTTGTACCGCGCGTCGTCGAGGTGCTGGAGAATCTTGGCCGACTT
GTGGTTCAGAATGATGAAGGTCACACGGCAGTGGTGGCGCTCCAGCACGGCATCGTCATTGTGCGTGAGTGCCATGGGGCTCAGCGTCCGGAGCTCAAAG
TCGTTCGAGTTGCCAGGGTGGTCAATGTCGTGGCACAGCGCCGCGAGCAGCATGGCAAAGATCTCGACGCCCGAGAAGAACTTGCGGCACTCGCGGCGCA
CGATCGAGTGCATGGTCAGCAACACCTGCAGCGCGTGGTGAAAGTTGTGGAACGGGTTGCTGCGGTAGTAGTTGGCCACGTTGGTCGTGAAGGCCGCAAA
CGTCTCGGGCGCGATGCGAAAAGTCTCGAGAAAACCATAGGCGCGGAACACGGCGCCACATGCGACGGCGATCTCACTGCTGGTGCTGATCGCGAGCGTA
TCCGTGTCCCACTGATCCAGTGGATCATCAACGCCGCCGGCGAAGACGATCTCGCGTGGGAAGGGGATCGCGTCGTCTTCCTGTTTCTTCCTGANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCACTATCGTTCGCGTTGTTAGTGGCGTTGCTGTGGCAGTACT
TGTGCACAATGGAAGAGATAATATCGGGTTCCGAGAGACCGTCGAGCCGGCCGGTGGTCCCCCCAACGGCAGCAGCGGTGTCACCATCGATAAATCCTTC
CGCTACGACTGTGGCGCAGTCGTACACCACCTTGTAGTACGAGATATCGAGCGAGAGACGCCCCAGTGCGAACTGCACTTCGCGGCAGAACTTCTCCATG
ACGTCGCGGTCCGTCTTGGTGAACGCCACGACGTGGGAGCCTTCTTTCTTGTTGATACACATGGCGACGGCCACGACCTTGGGTGTCACCGTCAGTGTCG
CGTGATCCTCCATCACGGGCATGCACAGCACGCTCGTCGTGCGGTAGCCCGTCTGGAGATCGACGTTCGGGTCAAACAGCTCGTGCTTGTACGCATCGCG
CGTCCACACGGGCTGGCCAGTGGTCGCCACCAGTCCCGAGATGCCTCGGTTCATGGGCGTGCGAATGCCCGCGCTCTCGCTGCCGCTGGCAGCGCCACCG
CTGACCACGCGCGGCGTGATCCACAGCTCCTTCTTGAAATGGTCAATGAGCAAGAACCCAAAGCGGTCGCACTCCATGATATCCTTGCCGACGTCCATGA
CCAAGTCCACGAAGCGTTCAATATCAGTACTCTCGGCGAGAAACGTCGTGAGCTGGAGCCGCGCTTCGATGAGCTTATGGGCTGTCTTGACTTCGTGGTG
AAGGCTCGCCTTGTGGAGCGAAATGCCGACGGCGTCGGCGGCGTAGTTGAGAAATACGGCGTCCTCGCGGGAGAAGTCGGTATTGTCAATCTTGTTGACG
GCCGAGACCACGGCGAGGATGTGGCCATCGGGCGACTTGACGGGAAGACACAGGATGCGCTTGGTGACGAAGCCCGTCTTGTGGTCGAGCGTCGGGTCGA
ACATGGCGTGCGAGTACGCGTCGTTCGTGATCACGGTCTCTCCGGTCCGCGCTACGTGGCCCACAATGCCCTTGGTGATGGGCATGTACTCGCCGCGTAC
AATGTCGGCTGCGCAGGCAATGTACAGCTCGTCCTCGGACTCGCCTTCGACCTTCATGAAGAGGCCAATACGTTCCGTGCCAATGAGCTCGTGGCACACC
GAGAGCACTTGGTCCAAGACGGTGGACGACACGGCCTCCATGGAGATGTTGCGGTGCAACTTGAGGAGCCCTTCGATGCGACTCTGAGCGGTCTGTCGCT
CACGGAAGAGGATCAAGTTCCAGATCGCCGCGCCGGCGACGACCGCGAGGAACTCGAGGCTGCGCGTGTCCGTGTCAACGAAGACGTCCTTTGTTGGTGT
CGTTGGCACGCGAGGTGGTGGCGTCGTGCCGTTCATGGAGACGACCTGGAGCACGCCGACGATGGCGCTGTGGGCGTTGCAAATGGGCAGACACAGCAGC
GCGCGCGGACTCGCGCCGCCGTTGTTGCCGCGCTTGATCTGGTCGGCGTACGTCTCATACGTGTAGAAGTCTTCGATGTGGAGCGGCTTGCCCGT